If the sequence of bases in one of the DNA strand is A G G A G A A, then the sequence of bases in the other complementary strand of DNA would be
1. C C T T C T T
2. T C T C T C C 
3. T C C T C T T
4. C C T C T C T

Subtopic:  DNA Replication | Transcription |
 94%
Level 1: 80%+
Please attempt this question first.
Hints
Please attempt this question first.

Human genome project was closely associated with the rapid development of a new area in biology called _____.
1. Biotechnology
2. Bioinformatics
3. Biofortification
4. Microbiology
Subtopic:  Human Genome Project |
 82%
Level 1: 80%+
Please attempt this question first.
Hints
Please attempt this question first.

If the sequence of one strand of DNA is 5' A T G C  A T C G 3', find the sequence of complementary strand in 5' → 3' direction 
1. T A C G T A G C 
2. C G A T G C A T 
3. A T G C A T C G 
4. A T C G T A C G 
Subtopic:  Transcription |
 60%
Level 2: 60%+
Please attempt this question first.
Hints
Please attempt this question first.

advertisementadvertisement

The synthesis of DNA is discontinuous on one strand of the replication fork because:
1. DNA molecule being synthesised is very long
2. DNA-dependent DNA polymerase catalyse polymerisation only in one direction \((5' \rightarrow 3')\)
3. It is a more efficient process
4. It help to use DNA ligase
Subtopic:  The DNA | DNA Double Helix |
 90%
Level 1: 80%+
Please attempt this question first.
Hints
Please attempt this question first.

Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation. 
3'AUCAGGUUUGUGAUGGUACGA5'
1. Phenylalanine, Methionine 
2. Cysteine, Glycine 
3. Alanine, Proline 
4. Serine, Valine 
Subtopic:  Genetic Code |
 70%
Level 2: 60%+
Please attempt this question first.
Hints
Please attempt this question first.

Select the important goals of HGP from the given options : 
(i) Store the information for data analysis.
(ii) Cloning and amplification of human DNA.
(iii) Identify all the genes present in human DNA. 
(iv) Use of DNA information to trace human history.
1. (i) and (ii) 
2. (ii) and (iii) 
3. (i) and (iii) 
4. (ii) and (iv) 
Subtopic:  Human Genome Project |
 81%
Level 1: 80%+
Please attempt this question first.
Hints
Please attempt this question first.

advertisementadvertisement

'A codon is a Triplet of bases was suggested by :
1. Marshall Nirenberg 
2. Har Gobind Khorana 
3. George Gamow 
4. Francis Crick 
Subtopic:  Genetic Code |
 74%
Level 2: 60%+
Please attempt this question first.
Hints
Please attempt this question first.

The correct feature of double-helical structure of DNA as given by Watson and Crick is: 
1. Right-handed helix, pitch is \(3.4~ \text {nm}\)
2. Left-handed helix, pitch is \(3.8~ \text {nm}\)
3. Right-handed helix, pitch is \(3.8~ \text {nm}\)
4. Left-handed helix, pitch is \(3.4~ \text {nm}\)
Subtopic:  DNA Double Helix |
 92%
Level 1: 80%+
Please attempt this question first.
Hints
Please attempt this question first.

Charging of tRNA during translation is necessary for : 
1. Binding of anticodons of tRNA to the respective codons of mRNA. 
2. Peptide bond formation between two amino acids.
3. Movement of ribosomes from codon to codon.
4. Binding of ribosomes to the mRNA. 
Subtopic:  Translation |
 60%
Level 2: 60%+
Please attempt this question first.
Hints
Please attempt this question first.

advertisementadvertisement

If E. coli were allowed to grow in the culture medium for 80 minutes by Matthew Meselson and Franklin Stahl in their experiments, the proportion of light and hybrid density DNA molecule would have been: 
1. 87.5% of light density DNA and 12.5% of hybrid density DNA. 
2. 75.0% of light density DNA and 25% of hybrid density DNA. 
3. 50% of light density DNA and 50% of hybrid density DNA.
4. 12.5% of light density DNA and 87.5% of hybrid density DNA.
Subtopic:  DNA Replication |
 70%
Level 2: 60%+
Please attempt this question first.
Hints
Please attempt this question first.