Given below is a sequence of bases in mRNA of a bacterial cell. Identify the amino acid that would be incorporated at codon position 3 and codon position 5 during the process of its translation. 
3'AUCAGGUUUGUGAUGGUACGA5'
1. Phenylalanine, Methionine 
2. Cysteine, Glycine 
3. Alanine, Proline 
4. Serine, Valine 

Subtopic:  Genetic Code |
 70%
From NCERT
Please attempt this question first.
Hints
Please attempt this question first.

Study the following lists: 
List I  List II 
i.  Vector  a.  Resistant to cotton bollworms. 
ii.  Downstream processing  b.  Mobile genetic elements 
iii.  Cry II AB c.  Controls corn borer 
iv.  Transposons  d.   Ti plasmid  
e.  Purifying protein in biopharmaceuticals.
1. (i-c); (ii-e); (iii-d); (iv-b)
2. (i-d); (ii-e); (iii-b); (iv-c)
3. (i-d); (ii-e); (iii-a); (iv-b)
4. (i-d); (ii-b); (iii-a); (iv-e)
Subtopic:  Bt Crops |
 84%
From NCERT
Please attempt this question first.
Hints
Please attempt this question first.

Select the important goals of HGP from the given options : 
(i) Store the information for data analysis.
(ii) Cloning and amplification of human DNA.
(iii) Identify all the genes present in human DNA. 
(iv) Use of DNA information to trace human history.
1. (i) and (ii) 
2. (ii) and (iii) 
3. (i) and (iii) 
4. (ii) and (iv) 
Subtopic:  Human Genome Project |
 80%
From NCERT
Please attempt this question first.
Hints
Please attempt this question first.

advertisementadvertisement

'A codon is a Triplet of bases was suggested by :
1. Marshall Nirenberg 
2. Har Gobind Khorana 
3. George Gamow 
4. Francis Crick 
Subtopic:  Genetic Code |
 73%
From NCERT
Please attempt this question first.
Hints
Please attempt this question first.

The correct feature of double-helical structure of DNA as given by Watson and Crick is: 
1. Right-handed helix, pitch is \(3.4~ \text {nm}\)
2. Left-handed helix, pitch is \(3.8~ \text {nm}\)
3. Right-handed helix, pitch is \(3.8~ \text {nm}\)
4. Left-handed helix, pitch is \(3.4~ \text {nm}\)
Subtopic:  DNA Double Helix |
 91%
From NCERT
Please attempt this question first.
Hints
Please attempt this question first.

Charging of tRNA during translation is necessary for : 
1. Binding of anticodons of tRNA to the respective codons of mRNA. 
2. Peptide bond formation between two amino acids.
3. Movement of ribosomes from codon to codon.
4. Binding of ribosomes to the mRNA. 
Subtopic:  Translation |
 60%
From NCERT
Please attempt this question first.
Hints
Please attempt this question first.

advertisementadvertisement

If E. coli were allowed to grow in the culture medium for 80 minutes by Matthew Meselson and Franklin Stahl in their experiments, the proportion of light and hybrid density DNA molecule would have been: 
1. 87.5% of light density DNA and 12.5% of hybrid density DNA. 
2. 75.0% of light density DNA and 25% of hybrid density DNA. 
3. 50% of light density DNA and 50% of hybrid density DNA.
4. 12.5% of light density DNA and 87.5% of hybrid density DNA.
Subtopic:  DNA Replication |
 68%
From NCERT
Please attempt this question first.
Hints
Please attempt this question first.

A diagramatic illustration of the process of transcription by RNA polymerase-II in eukaryote is given below. Choose the most appropriate statement with respect to the fate of the precursor of mRNA transcribed that will be : 


1. Translation will take place once the precursor of mRNA leaves the nucleus.
2. Translation on mRNA will not take place once the precursor of mRNA leaves the nucleus.
3. Translation will take place in the nucleus.
4. The precursor of mRNA has to be processed further in next step before being translated.
 
Subtopic:  Transcription |
From NCERT
Please attempt this question first.
Hints

Identify the correct pair of codon with its corresponding pair of amino acid : 
1. UAA : Leucine 
2. UGA : Serine 
3. AUG : Histidine
4. UUU : Phenylalanine 

 
Subtopic:  Genetic Code |
 89%
From NCERT
Please attempt this question first.
Hints
Please attempt this question first.

advertisementadvertisement

Consider the given two statements:
Assertion: If each strand from a parental DNA acts as a template for synthesis of a new strand, the two
double stranded daughter DNA thus, produced would be identical to the parental DNA molecule.
Reason: For a double stranded DNA, the ratios between Adenine and Thymine and Guanine and Cytosine
are constant and equals one.

1. Both Assertion and Reason are true and Reason correctly explains the Assertion.
2. Assertion is true but Reason is false.
3. Both Assertion and Reason are true but Reason does not correctly explain the Assertion.
4. Assertion is false but Reason is true.
Subtopic:  DNA Double Helix |
 54%
From NCERT
Please attempt this question first.
Hints
Please attempt this question first.