Q. No.1. Transcription of only snRNAs
2. Transcription of rRNAs (28S, 18S and 5.8S)
3. Transcription of tRNA, 5 srRNA and snRNA
4. Transcription of precursor of mRNA
5'AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'?
1. 3' ATCGATCGATCGATCGATCGATCGATCG 5'
2. 5' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3'
3. 3' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5'
4. 5' ATCGATCGATCGATCGATCGATCGATCG 3'
| I: | The process of copying genetic information from one strand of the DNA into RNA is termed as transcription |
| II: | A transcription unit in DNA is defined primarily by the three regions in the DNA i.e. a promoter, the structural gene and a terminator. |
1. Statement I is true but Statement II is false
2. Statement I is false but Statement II is true
3. Both Statement I and Statement II are true
4. Both Statement I and Statement II are false
What is the role of RNA polymerase III in the process of transcription in eukaryotes?
1. Transcribes precursor of mRNA
2. Transcribes only snRNAs
3. Transcribes rRNAs (28S, 18S and 5.8S)
4. Transcribes tRNA, 5s rRNA and snRNA
Identify the correct statement:
| 1. | The coding strand in a transcription unit is copied to an mRNA. |
| 2. | Split gene arrangement is characteristic of prokaryotes. |
| 3. | In capping, methylguanosine triphosphate is added to the 3' end of hnRNA. |
| 4. | RNA polymerase binds with the Rho factor to terminate the process of transcription in bacteria. |
Which of the following RNAs is not required for the synthesis of protein?
1. rRNA
2. siRNA
3. mRNA
4. tRNA
Which is the "Only enzyme" that has the "Capability" to catalyze Initiation, Elongation, and Termination in the process of transcription in prokaryotes?
1. DNA Ligase
2. DNase
3. DNA-dependent DNA polymerase
4. DNA-dependent RNA polymerase
Name the enzyme that facilitates opening of DNA helix during transcription.
1. DNA helicase
2. DNA polymerase
3. RNA polymerase
4. DNA ligase
Match the following RNA polymerases with their transcribed products:
|
Column-I |
Column-II |
||
|
(a) |
RNA polymerase I |
(i) |
tRNA |
|
(b) |
RNA polymerase II |
(ii) |
rRNA |
|
(c) |
RNA polymerase III |
(iii) |
hnRNA |
Select the correct option from the following:
| Options: | (a) | (b) | (c) |
| 1. | i | iii | ii |
| 2. | i | ii | iii |
| 3. | ii | iii | i |
| 4. | iii | ii | i |
In the process of transcription in Eukaryotes, the RNA polymerase I transcribe -
1. mRNA with additional processing, capping and tailing
2. tRNA, 5 S rRNA and snRNAs
3. rRNAs - 28 S, 18 S and 5.8 S
4. Precursor of mRNA, hnRNA
© 2024 GoodEd Technologies Pvt. Ltd.