The salient features of genetic code are:
(A) The code is palindromic
(B) UGA act as initiator codon
(C) The code is unambiguous and specific
(D) The code is nearly universal
Choose the most appropriate answer from the options given below:
1. (A) and (D) only 2. (B) and (C) only
3. (A) and (B) only 4. (C) and (D) only

Subtopic:  Genetic Code |
 77%
Level 2: 60%+
NEET - 2023
Hints

With reference to Hershey and Chase experiments, select the correct statements:
A: Viruses grown in the presence of radioactive phosphorus contained radioactive DNA.
B: Viruses grown on radioactive sulphur contained radioactive proteins.
C: Viruses grown on radioactive phosphorus contained radioactive protein
D: Viruses grown on radioactive sulphur contained radioactive DNA
E: Viruses grown on radioactive protein contained radioactive DNA
Choose the most appropriate answer from the options given below:
1. (D) and (E) only 2. (A) and (B) only
3. (A) and (C) only 4. (B) and (D) only
Subtopic:  Search for Genetic Material |
 84%
Level 1: 80%+
NEET - 2023
Hints

Which one of the following acts as an inducer for lac operon?
1.Sucrose2.Lactose
3.Glucose4.Galactose
Subtopic:  Gene Regulation: Lac Operon |
 91%
Level 1: 80%+
NEET - 2023
Hints

advertisementadvertisement

Given below are two statements:
Statement I: RNA being unstable, it mutates at a faster rate
Statement II: RNA can directly code for synthesis of proteins hence can easily express the characters.
In the light of the above statements, choose the correct answer from the options given below:
1. Statement I is correct but Statement II is incorrect.
2. Statement I is incorrect but Statement II is correct
3. Both Statement I and Statement II are correct
4. Both Statement I and Statement II are incorrect 
Subtopic:  DNA vs RNA as Genetic Material |
 87%
Level 1: 80%+
NEET - 2023
Hints

Which scientist conducted an experiment with 32p and 35s labelled phages for demonstrating that DNA is the genetic material?
1. James D. Watson and F.H.C Crick
2. A.D. Hershey and M.J. Chase
3. F. Griffith
4. O.T. Avery, C.M. MacLeod and M. McCarty
Subtopic:  Search for Genetic Material |
 84%
Level 1: 80%+
NEET - 2023
Hints

Given below are two statements:
Statement I: The process of copying genetic information from one strand of the DNA into RNA is termed as transcription
Statement II: A transcription unit in DNA is defined primarily by the three regions in the DNA i.e. a promoter, the structural gene and a terminator.
In the light of the above statements, choose the correct answer from the options given below:

1. Statement I is true but Statement II is false
2. Statement I is false but Statement II is true
3. Both Statement I and Statement II are true
4. Both Statement I and Statement II are false
Subtopic:  Transcription |
 89%
Level 1: 80%+
NEET - 2023
Hints

advertisementadvertisement

Name the component that binds to the operator region of an operon and prevents RNA polymerase from transcribing the operon.
1.Promotor2.Regulator protein
3.Repressor protein4.Inducer
Subtopic:  Gene Regulation: Lac Operon |
 75%
Level 2: 60%+
NEET - 2023
Hints

The last chromosome sequenced in Human Genome project was:
1. Chromosome 6 2. Chromosome 1
3. Chromosome 22 4. Chromosome 14
Subtopic:  Human Genome Project |
 78%
Level 2: 60%+
NEET - 2023
Hints

Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows
 5'AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'?
1. 3' ATCGATCGATCGATCGATCGATCGATCG 5'
2. 5' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3'
3. 3' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5'
4. 5' ATCGATCGATCGATCGATCGATCGATCG 3'
Subtopic:  Transcription: I | Transcription:II | Transcription: III | Transcription: IV | Transcription |
 52%
Level 3: 35%-60%
NEET - 2023
Hints

advertisementadvertisement

Given below are two statements:
Statement I: RNA mutates at a faster rate.
Statement II: Viruses having RNA genome and shorter life span mutate and evolve faster.
In the light of the above statements, choose the correct answer from the options given below:
1. Statement I is false but Statement II is true.
2. Both Statement I and Statement II are true.
3. Both Statement I and Statement II are false.
4. Statement I is true but Statement II is false.
Subtopic:  DNA vs RNA as Genetic Material |
 91%
Level 1: 80%+
NEET - 2023
Hints