NEET Botany Molecular Basis of Inheritance Questions Solved

BOARD

Given below are the sequence of nucleotides in a particular mRNA and amino acids coded by it :

    UUUAUGUUCGAGUUAGUGUAA

    Phe - Met - Phe - Glu - Leu - Val

Write the properties of genetic code that can be and that cannot be correlated from the above given data.                                                                                                        3 mark

Properties of genetic code :

(i) One codon codes for one amino acid hence the code is unambiguous and specific.

(ii) Some amino acids are coded by more than one codon, hence the code is degenerate.

(iii) The code is read in mRNA in a contiguous fashion. There are no punctuations.

(iv) The code is nearly universal, e.g., from bacteria to human vvv would code for Phenylalanine.

(v) AUG has dual function. It codes for methionine (met), and it also acts as an initiator codon. This property is not co-related from the above given data.                                                  3 mark

Difficulty Level:

  • 100%
  • 0%
  • 0%
  • 0%
Crack NEET with Online Course - Free Trial (Offer Valid Till August 23, 2019)