Given below are the sequence of nucleotides in a particular mRNA and amino acids coded by it :

    UUUAUGUUCGAGUUAGUGUAA

    Phe - Met - Phe - Glu - Leu - Val

Write the properties of genetic code that can be and that cannot be correlated from the above given data.                                                                                                        3 mark

To view Explanation, Please buy any of the course from below.
Complete Question Bank + Test Series
Complete Question Bank

Difficulty Level: