NEET Zoology Biotechnology Principles and Processes Questions Solved


If a DNA strand has sequence 3’TAACGCTTGGCCAAGTCAGTCAG 5’

Design the primer for the strand has polarity 3’ to 5’

A.      5’ ATTGC 3’

B.      5’ TAAGC 3’

C.      3’ ATTGC 5’

D.     3’ TAAGC 5’

Explanation is a part of a Paid Course. To view Explanation Please buy the course.

Difficulty Level: