NEET Zoology Biotechnology Principles and Processes Questions Solved


If a DNA strand has sequence 3’TAACGCTTGGCCAAGTCAGTCAG 5’

Design the primer for the strand has polarity 3’ to 5’

A.      5’ ATTGC 3’

B.      5’ TAAGC 3’

C.      3’ ATTGC 5’

D.     3’ TAAGC 5’

Apply principle of complementarity

Difficulty Level:

  • 53%
  • 22%
  • 13%
  • 14%
Crack NEET with Online Course - Free Trial (Offer Valid Till August 25, 2019)