NEET Zoology Biotechnology Principles and Processes Questions Solved

If a DNA strand has sequence 5’ATTGCGCTTGGCCAAGTCAGTCAG 3’

Design the primer for the strand has polarity 3’ to 5’

A.      5’ATTGC 3’

B.      5’TAACG 3’

C.      3’ATTGC 5’

D.     3’TAACG5’

Apply principle of complementarity


Difficulty Level:

  • 28%
  • 21%
  • 22%
  • 31%
Crack NEET with Online Course - Free Trial (Offer Valid Till August 24, 2019)