NEET Zoology Biotechnology Principles and Processes Questions Solved


If a DNA strand has sequence 5’ATTGCGCTTGGCCAAGTCAGTCAG 3’

Design the primer for the strand has polarity 3’ to 5’

A.      5’ATTGC 3’

B.      5’TAACG 3’

C.      3’ATTGC 5’

D.     3’TAACG5’

Explanation is a part of a Paid Course. To view Explanation Please buy the course.

Difficulty Level: