The synthesis of DNA in PCR will be in

A.      5’-3’

B.      3’-5’

C.      It won't be depending on direction

D.     For one strand 5’-3’ in another opposite to it

Concept Questions :-

Large Scale Production: I
To view Explanation, Please buy any of the course from below.
High Yielding Test Series + Question Bank - NEET 2020

Difficulty Level:

The primers designed according to (Answer according to very basic PCR)

A.      Terminal ends of vector

B.      Terminal ends of gene of interest

C.      Random primers

D.     According to direction of PCR

To view Explanation, Please buy any of the course from below.
High Yielding Test Series + Question Bank - NEET 2020

Difficulty Level:

Primers are not

A.      Small

B.      Biologically synthesised

C.      Oligonucleotides

D.     Complementary to the regions of DNA

To view Explanation, Please buy any of the course from below.
High Yielding Test Series + Question Bank - NEET 2020

Difficulty Level:

Which of the following doesn't go with PCR?

A.      Thermus aquaticus

B.      1 billion copies

C.      Taq polymerase

D.     Dideoxynucleotides

To view Explanation, Please buy any of the course from below.
High Yielding Test Series + Question Bank - NEET 2020

Difficulty Level:

If a strand has following sequence 5’ATTGCCCTAG 3’what will be the sequence of DNA synthesized from its complementary strand.

A.      5’TAACGGGATC 3’

B.      3’TAACGGGATC 5’

C.      5’ATTGCCCTAG 3’

D.     3’ATTGCCCTAG 5’

To view Explanation, Please buy any of the course from below.
High Yielding Test Series + Question Bank - NEET 2020

Difficulty Level:

If a DNA strand has sequence 3’TAACGCTTGGCCAAGTCAGTCAG 5’

Design the primer for the strand has polarity 3’ to 5’

A.      5’ ATTGC 3’

B.      5’ TAAGC 3’

C.      3’ ATTGC 5’

D.     3’ TAAGC 5’

To view Explanation, Please buy any of the course from below.
High Yielding Test Series + Question Bank - NEET 2020

Difficulty Level:

If a DNA strand has to undergo denaturation in PCR

A.      Need to give optimal conditions

B.      Temperature should be above 90 degree Celsius

C.      Need to give Taq polymerase

D.     A strand cannot undergo denaturation because of absence of hydrogen bonds

Concept Questions :-

Large Scale Production: I
To view Explanation, Please buy any of the course from below.
High Yielding Test Series + Question Bank - NEET 2020

Difficulty Level:

If you start with 10 molecules of Double stranded DNA, what will be the number of DNA molecules formed after 10 cycles of PCR?

A.      10240

B.      1024

C.      512

D.     5120

To view Explanation, Please buy any of the course from below.
High Yielding Test Series + Question Bank - NEET 2020

Difficulty Level:

What is the final step of PCR?

A.      Extension

B.      Annealing

C.      Denaturation

D.     Extraction

To view Explanation, Please buy any of the course from below.
High Yielding Test Series + Question Bank - NEET 2020

Difficulty Level:

After 30 cycle of PCR, how many times DNA will be amplified?

A.      Thousand times

B.      Million times

C.      Billion times

D.     Hundreds times

To view Explanation, Please buy any of the course from below.
High Yielding Test Series + Question Bank - NEET 2020

Difficulty Level: