| A. | Transport of pre-mRNA to the cytoplasm prior to splicing |
| B. | Removal of introns and joining of exons. |
| C. | Addition of methyl group at 5' end of hnRNA. |
| D. | Addition of adenine residues at 3' end of hnRNA. |
| E. | Base pairing of two complementary RNAs. |
| 1. | B, C, E only | 2. | C, D, E only |
| 3. | A, B, C only | 4. | B, C, D only |
| Statement I: | Transfer RNAs and ribosomal RNA do not interact with mRNA. |
| Statement II: | RNA interference (RNAi) takes place in all eukaryotic organisms as a method of cellular defence. |
| 1. | Statement I is correct but Statement II is incorrect |
| 2. | Statement I is incorrect but Statement II is correct |
| 3. | Both Statement I and Statement II are correct |
| 4. | Both Statement I and Statement II are incorrect |
| 1. | \(\rho\) (rho) | 2. | \(\gamma\) (gamma) |
| 3. | \(\alpha\) (alpha) | 4. | \(\sigma\) (sigma) |
| Statement I: | In prokaryotes, RNA polymerase is capable of catalysing the process of elongation during transcription. |
| Statement II: | RNA polymerase associates transiently with 'Rho' factor to initiate transcription. |
| Statement I: | In eukaryotes, there are three RNA polymerases in the nucleus in addition to the RNA polymerase found in the organelle. |
| Statement II: | All the three RNA polymerases in eukaryotic nucleus have different roles. |
| 1. | 3' ATCGATCGATCGATCGATCGATCGATCG 5' |
| 2. | 5' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3' |
| 3. | 3' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5' |
| 4. | 5' ATCGATCGATCGATCGATCGATCGATCG 3' |
| Statement I: | The process of copying genetic information from one strand of the DNA into RNA is termed as transcription |
| Statement II: | A transcription unit in DNA is defined primarily by the three regions in the DNA i.e. a promoter, the structural gene and a terminator. |
Identify the correct statement:
| 1. | The coding strand in a transcription unit is copied to an mRNA. |
| 2. | Split gene arrangement is characteristic of prokaryotes. |
| 3. | In capping, methylguanosine triphosphate is added to the 3' end of hnRNA. |
| 4. | RNA polymerase binds with the Rho factor to terminate the process of transcription in bacteria. |
Which of the following RNAs is not required for the synthesis of protein?
| 1. | rRNA | 2. | siRNA |
| 3. | mRNA | 4. | tRNA |