If a strand has following sequence 5’ATTGCCCTAG 3’what will be the sequence of DNA synthesized from its complementary strand.

A.      5’TAACGGGATC 3’

B.      3’TAACGGGATC 5’

C.      5’ATTGCCCTAG 3’

D.     3’ATTGCCCTAG 5’

To view Explanation, Please buy any of the course from below.
High Yielding Test Series + Question Bank - NEET 2020

Difficulty Level:


If a DNA strand has sequence 3’TAACGCTTGGCCAAGTCAGTCAG 5’

Design the primer for the strand has polarity 3’ to 5’

A.      5’ ATTGC 3’

B.      5’ TAAGC 3’

C.      3’ ATTGC 5’

D.     3’ TAAGC 5’

To view Explanation, Please buy any of the course from below.
High Yielding Test Series + Question Bank - NEET 2020

Difficulty Level:


If a DNA strand has to undergo denaturation in PCR

A.      Need to give optimal conditions

B.      Temperature should be above 90 degree Celsius

C.      Need to give Taq polymerase

D.     A strand cannot undergo denaturation because of absence of hydrogen bonds

Concept Questions :-

Large Scale Production: I
To view Explanation, Please buy any of the course from below.
High Yielding Test Series + Question Bank - NEET 2020

Difficulty Level:


If you start with 10 molecules of Double stranded DNA, what will be the number of DNA molecules formed after 10 cycles of PCR?

A.      10240

B.      1024

C.      512

D.     5120

To view Explanation, Please buy any of the course from below.
High Yielding Test Series + Question Bank - NEET 2020

Difficulty Level:


What is the final step of PCR?

A.      Extension

B.      Annealing

C.      Denaturation

D.     Extraction

To view Explanation, Please buy any of the course from below.
High Yielding Test Series + Question Bank - NEET 2020

Difficulty Level:


After 30 cycle of PCR, how many times DNA will be amplified?

A.      Thousand times

B.      Million times

C.      Billion times

D.     Hundreds times

To view Explanation, Please buy any of the course from below.
High Yielding Test Series + Question Bank - NEET 2020

Difficulty Level:


Use of primers, occurs in which step of PCR?

A.      Annealing

B.      Extension

C.      Denaturation

D.     Both extension and Annealing

To view Explanation, Please buy any of the course from below.
High Yielding Test Series + Question Bank - NEET 2020

Difficulty Level:


If you have transformed cell with recombinant DNA and it grows on kanamycin and chloramphenicol containing plates but does not grow on ampicillin containing medium. What does it imply?

A.      The cell has resistance against ampicillin but not against chloramphenicol and kanamycin

B.      Has resistance against both kanamycin and chloramphenicol but not against ampicillin

C.      We may not confer anything from it

D.     It depends upon gene of interest

To view Explanation, Please buy any of the course from below.
High Yielding Test Series + Question Bank - NEET 2020

Difficulty Level:


The ultimate aim of maximum recombinant DNA technologies is

A.    To multiply DNA

B.    To express DNA

C.   To multiply mRNA

D.   To express protein

Concept Questions :-

Large Scale Production:III
To view Explanation, Please buy any of the course from below.
High Yielding Test Series + Question Bank - NEET 2020

Difficulty Level:


Which of the following processes will be last?

A.      Purification of DNA

B.      Purification of protein

C.      Expression of protein

D.     Multiplication of recombinant DNA

Concept Questions :-

Large Scale Production: II
To view Explanation, Please buy any of the course from below.
High Yielding Test Series + Question Bank - NEET 2020

Difficulty Level: