The precipitation of DNA out of the solution is done by adding

A.      Organic Acid

B.      HCl

C.      Ethanol

D.     Ketone

To view Explanation, Please buy any of the course from below.
High Yielding Test Series + Question Bank - NEET 2020

Difficulty Level:

The end result of precipitation of DNA in suspension is seen

A.      In the form of dark solution

B.      In the form of effervescence

C.      In the form of fine threads

D.     In the form of bubbles

To view Explanation, Please buy any of the course from below.
High Yielding Test Series + Question Bank - NEET 2020

Difficulty Level:

The precipitated DNA can be removed from the suspension

A.      By Filtration

B.      By giving a heat shock

C.      By spooling

D.     By gel electrophoresis

To view Explanation, Please buy any of the course from below.
High Yielding Test Series + Question Bank - NEET 2020

Difficulty Level:

For the synthesis of 4 copies of DNA, how many sets of primers are needed in PCR

A.      2 sets

B.      8 sets

C.      4 sets

D.     Random

To view Explanation, Please buy any of the course from below.
High Yielding Test Series + Question Bank - NEET 2020

Difficulty Level:

The synthesis of DNA in PCR will be in

A.      5’-3’

B.      3’-5’

C.      It won't be depending on direction

D.     For one strand 5’-3’ in another opposite to it

To view Explanation, Please buy any of the course from below.
High Yielding Test Series + Question Bank - NEET 2020

Difficulty Level:

The primers designed according to (Answer according to very basic PCR)

A.      Terminal ends of vector

B.      Terminal ends of gene of interest

C.      Random primers

D.     According to direction of PCR

To view Explanation, Please buy any of the course from below.
High Yielding Test Series + Question Bank - NEET 2020

Difficulty Level:

Primers are not

A.      Small

B.      Biologically synthesised

C.      Oligonucleotides

D.     Complementary to the regions of DNA

To view Explanation, Please buy any of the course from below.
High Yielding Test Series + Question Bank - NEET 2020

Difficulty Level:

Which of the following doesn't go with PCR?

A.      Thermus aquaticus

B.      1 billion copies

C.      Taq polymerase

D.     Dideoxynucleotides

To view Explanation, Please buy any of the course from below.
High Yielding Test Series + Question Bank - NEET 2020

Difficulty Level:

If a strand has following sequence 5’ATTGCCCTAG 3’what will be the sequence of DNA synthesized from its complementary strand.

A.      5’TAACGGGATC 3’

B.      3’TAACGGGATC 5’

C.      5’ATTGCCCTAG 3’

D.     3’ATTGCCCTAG 5’

To view Explanation, Please buy any of the course from below.
High Yielding Test Series + Question Bank - NEET 2020

Difficulty Level:

If a DNA strand has sequence 3’TAACGCTTGGCCAAGTCAGTCAG 5’

Design the primer for the strand has polarity 3’ to 5’

A.      5’ ATTGC 3’

B.      5’ TAAGC 3’

C.      3’ ATTGC 5’

D.     3’ TAAGC 5’

To view Explanation, Please buy any of the course from below.
High Yielding Test Series + Question Bank - NEET 2020

Difficulty Level: