The lactose present in the growth medium of bacteria is transported to the cell by the action of:
1. Acetylase
2. Permease
3. Polymerase
4. Beta-galactosidase

Subtopic:  Gene Regulation: Lac Operon |
 64%
Level 2: 60%+
NEET - 2024
Hints

Match List I with List II:
List I List II
A. Frederick Griffith I. Genetic code
B. Francois Jacob & Jacque Monod II. Semi-conservative mode of DNA replication
C. Har Gobind Khorana III. Transformation
D. Meselson Stahl IV. Lac operon

Choose the correct answer from the options given below:
1. A-III, B-IV, C-I, D-II
2. A-II, B-III, C-IV, D-I
3. A-IV, B-I, C-II, D-III
4. A-III, B-II, C-I, D-IV
Subtopic:  Search for Genetic Material:I | Genetic Code: I | Gene Regulation: Lac Operon | Search for Genetic Material |
 81%
Level 1: 80%+
NEET - 2024
Hints

Which of the following statement is correct regarding the process replication in E. coli
1. The DNA dependent RNA polymerase catalyses polymerization in one direction, that is 5' \(\rightarrow\) 3'
2. The DNA dependent DNA polymerase catalyses polymerization in  5' \(\rightarrow\) 3'  as well as the 3' \(\rightarrow\) 5' direction.
3. The DNA dependent DNA polymerase catalyses polymerization in  5' \(\rightarrow\) 3' direction.
4. The DNA dependent DNA polymerase catalyses polymerization in one direction which is 3' \(\rightarrow\) 5'.
Subtopic:  DNA Replication |
 57%
Level 3: 35%-60%
NEET - 2024
Hints

advertisementadvertisement

Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'
1. 5'AUGUAAAGUUUAUAGGUAAGU3'
2. 5'AUGUACCGUUUAUAGGGAAGU3'
3. 5'ATGTACCGTTTATAGGTAAGT3'
4. 5'AUGUACCGUUUAUAGGUAAGU3'
Subtopic:  Transcription: I |
 56%
Level 3: 35%-60%
NEET - 2024
Hints

Match List-I with List-II
List-I List-II
A. RNA polymerase III  I. snRNPs
B.  Termination of transcription II. Promotor
C. Splicing of Exons  III. Rho factor
D. TATA box IV. SnRNAs, tRNA
Choose the correct answer from the options given below: 
1. A-III, B-II, C-IV, D-I
2. A-III, B-IV, C-I, D-II
3. A-IV, B-III; C-I, D-II
4. A-II, B-IV, C-I, D-III
Subtopic:  Transcription:II | Transcription: III |
 86%
Level 1: 80%+
NEET - 2024
Hints

Which of the following is not the characteristic feature of genetic code?
1. The codon is triplet
2. The code is nearly universal
3. The code has punctuations
4. Some amino acids are coded by more than one codon, hence the code is degenerate
Subtopic:  Genetic Code |
 90%
Level 1: 80%+
NEET - 2024
Hints

advertisementadvertisement

Which of the following technique was used to elucidate the double helix model of DNA?
1. \(\gamma\)-radiation
2. Electromagnetic radiation
3. UV-Vis spectroscopy
4. X-ray diffraction
Subtopic:  DNA Double Helix |
 87%
Level 1: 80%+
NEET - 2024
Hints

Which experimental material was used by Taylor and colleagues to prove that DNA in chromosomes replicates semiconservatively?
1. Vicia faba 2. Pisum sativum
3. Solanum tuberosum 4. Oryza sativa
Subtopic:  DNA Replication |
 93%
Level 1: 80%+
NEET - 2024
Hints

In the lac operon, the i gene codes for:
1. Inducer 
2. Repressor
3. \(\beta\)-galactosidase
4. Permease
Subtopic:  Gene Regulation: Lac Operon |
 68%
Level 2: 60%+
NEET - 2024
Hints

advertisementadvertisement

A transcription unit in DNA is defined primarily by the three regions in DNA and these are with respect to upstream and downstream end:
1. Structural gene, Transposons, Operator gene
2. Inducer, Repressor, Structural gene
3. Promotor, Structural gene, Terminator 
4. Repressor, Operator gene, Structural gene
Subtopic:  Transcription: I |
 88%
Level 1: 80%+
NEET - 2024
Hints