Following are the stages of cell division :
Choose the correct sequence of stages from the options given below :
| A. | Gap 2 phase |
| B. | Cytokinesis |
| C. | Synthesis phase |
| D. | Karyokinesis |
| E. | Gap I phase |
| 1. | E-B-D-A-C |
| 2. | B-D-E-A-C |
| 3. | E-C-A-D-B |
| 4. | C-E-D-A-B |
Subtopic: Â Intro to Cell Cycle & Interphase |
 89%
Level 1: 80%+
NEET - 2024
Hints
In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on:
1. \(10^{\text {th }}\) segment
2. \(8^{\text {th }}\) and \(9^{\text {th }}\) segment
3. \(11^{\text {th }}\) segment
4. \(5^{\text {th }}\)segment
1. \(10^{\text {th }}\) segment
2. \(8^{\text {th }}\) and \(9^{\text {th }}\) segment
3. \(11^{\text {th }}\) segment
4. \(5^{\text {th }}\)segment
Subtopic: Â Cockroach: Intro & External Morphology |
 76%
Level 2: 60%+
NEET - 2024
Hints
Match List I with List II:
Choose the correct answer from the options given below:
1. A-I, B-III, C-II, D-IV
2. A-II, B-III, C-I, D-IV
3. A-III, B-I, C-IV, D-II
4. A-IV, B-II, C-III, D-I
| List I | List II | ||
| A. | Fibrous joints | I. | Adjacent vertebrae, limited movement |
| B. | Cartilaginous joints | II. | Humerus and Pectoral girdle, rotational movement |
| C. | Hinge joints | III. | Skull, don't allow any movement |
| D. | Ball and socket joints | IV. | Knee, help in locomotion |
Choose the correct answer from the options given below:
1. A-I, B-III, C-II, D-IV
2. A-II, B-III, C-I, D-IV
3. A-III, B-I, C-IV, D-II
4. A-IV, B-II, C-III, D-I
Subtopic: Â Fibrous & Catilaginous Joints |Â Synovial Joint |
 87%
Level 1: 80%+
NEET - 2024
Hints
Which of the following is not a steroid hormone?
1. Testosterone
2. Progesterone
3. Glucagon
4. Cortisol
1. Testosterone
2. Progesterone
3. Glucagon
4. Cortisol
Subtopic: Â Pancreas |
 81%
Level 1: 80%+
NEET - 2024
Hints
Following are the stages of pathway for conduction of an action potential through the heart:
Choose the correct sequence of pathway from the options given below:
| A. | AV bundle | B. | Purkinje fibres |
| C. | AV node | D. | Bundle branches |
| E. | SA node | ||
| 1. | A-E-C-B-D | 2. | B-D-E-C-A |
| 3. | E-A-D-B-C | 4. | E-C-A-D-B |
Subtopic: Â Human Heart: Cardiac Cycle |
 84%
Level 1: 80%+
NEET - 2024
Hints
Match List-I with List-II:
Choose the correct answer from the options given below:
1. A-I, B-III, C-IV, D-II
2. A-IV, B-I, C-II, D-III
3. A-III, B-I, C-IV, D-II
4. A-III, B-I, C-II, D-IV
| List-I | List-II | ||
| A. | Non-medicated IUD | I. | Multiload 375 |
| B. | Copper releasing IUD | II. | Progestogens |
| C. | Hormone releasing IUD | III. | Lippes loop |
| D. | Implants | IV. | LNG-20 |
Choose the correct answer from the options given below:
1. A-I, B-III, C-IV, D-II
2. A-IV, B-I, C-II, D-III
3. A-III, B-I, C-IV, D-II
4. A-III, B-I, C-II, D-IV
Subtopic: Â Contraception: Barrier Methods & IUDs |
 68%
Level 2: 60%+
NEET - 2024
Hints
Which of the following is not a natural/traditional contraceptive method?
| 1. | Periodic abstinence | 2. | Lactational amenorrhea |
| 3. | Vaults | 4. | Coitus interruptus |
Subtopic: Â Contraception: Natural Methods |
 88%
Level 1: 80%+
NEET - 2024
Hints
Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'
1. 5'AUGUAAAGUUUAUAGGUAAGU3'
2. 5'AUGUACCGUUUAUAGGGAAGU3'
3. 5'ATGTACCGTTTATAGGTAAGT3'
4. 5'AUGUACCGUUUAUAGGUAAGU3'
3'TACATGGCAAATATCCATTCA5'
1. 5'AUGUAAAGUUUAUAGGUAAGU3'
2. 5'AUGUACCGUUUAUAGGGAAGU3'
3. 5'ATGTACCGTTTATAGGTAAGT3'
4. 5'AUGUACCGUUUAUAGGUAAGU3'
Subtopic: Â Transcription: I |
 55%
Level 3: 35%-60%
NEET - 2024
Hints
Which one of the following factors will not affect the Hardy-Weinberg equilibrium?
1. Genetic drift
2. Gene migration
3. Constant gene pool
4. Genetic recombination
1. Genetic drift
2. Gene migration
3. Constant gene pool
4. Genetic recombination
Subtopic: Â Hardy Weinberg Law: 1 |
 79%
Level 2: 60%+
NEET - 2024
Hints
Match List-I with List-II:
Choose the correct answer from the options given below:
1. A-I, B-III, C-II, D-IV
2. A-II, B-I, C-III, D-IV
3. A-III, B-IV, C-I, D-II
4. A-IV, B-III, C-I, D-II
| List-I | List-II | ||
| A. | Cocaine | I. | Effective sedative in surgery |
| B. | Heroin | II. | Cannabis sativa |
| C. | Morphine | III. | Erythroxylum |
| D. | Marijuana | IV. | Papaver somniferum |
Choose the correct answer from the options given below:
1. A-I, B-III, C-II, D-IV
2. A-II, B-I, C-III, D-IV
3. A-III, B-IV, C-I, D-II
4. A-IV, B-III, C-I, D-II
Subtopic: Â Drugs & Alcohol Abuse |
 77%
Level 2: 60%+
NEET - 2024
Hints
© 2026 GoodEd Technologies Pvt. Ltd.