Given below are two statements:
In the light of the above statements, choose the correct answer from the options given below:
1. Both Statement I and Statement II are False
2. Statement I is True but Statement II is False
3. Statement I is False but Statement II is True
4. Both Statement I and Statement II are True
| Statement I: | Parenchyma is living but collenchyma is dead tissue. |
| Statement II: | Gymnosperms lack xylem vessels but presence of xylem vessels is the characteristic of angiosperms. |
1. Both Statement I and Statement II are False
2. Statement I is True but Statement II is False
3. Statement I is False but Statement II is True
4. Both Statement I and Statement II are True
Subtopic: Â Simple Tissue: Parenchyma |Â Simple Tissue: Chollenchyma & Sclerenchyma |Â Complex Tissue: Xylem |Â Complex Tissue: Phloem |
 66%
Level 2: 60%+
NEET - 2024
Hints
The lactose present in the growth medium of bacteria is transported to the cell by the action of:
| 1. | Acetylase | 2. | Permease |
| 3. | Polymerase | 4. | Beta-galactosidase |
Subtopic: Â Gene Regulation: Lac Operon |
 61%
Level 2: 60%+
NEET - 2024
Hints
Given below are two statements:
In the light of the above statements, choose the correct answer from the option given below:
| Statement I: | In \(\text{C}_3\) plants, some \( \text{O}_2\) binds to \(\text{RuBisCO},\) hence \(\text{CO}_2\) fixation is decreased. |
| Statement II: | In \( \text{C}_4\) plants, mesophyll cells show very little photorespiration while bundle sheath cells do not show photorespiration. |
In the light of the above statements, choose the correct answer from the option given below:
| 1. | Both Statement I and Statement II are False |
| 2. | Statement I is True but Statement II is False |
| 3. | Statement I is False but Statement II is True |
| 4. | Both Statement I and Statement II are True |
Subtopic: Â Photorespiration |
 58%
Level 3: 35%-60%
NEET - 2024
Hints
In an ecosystem, if the Net Primary Productivity (NPP) of first trophic level is \(100 x\left(\mathrm{kcal} ~\mathrm{m}^{-2}\right) \mathrm{yr}^{-1},\) what would be the GPP (Gross Primary Productivity) of the third trophic level of the same ecosystem?
| 1. | \(x\left(\mathrm{kcal}~ \mathrm{m}^{-2}\right) y r^{-1}\) |
| 2. | \(10 x\left(\mathrm{kcal} ~\mathrm{m}^{-2}\right) \mathrm{yr}^{-1}\) |
| 3. | \(\dfrac{100 x}{3 x}\left(\mathrm{kcal} ~\mathrm{m}^{-2}\right) \mathrm{yr}^{-1}\) |
| 4. | \(\dfrac{x}{10}\left(\mathrm{kcal} ~\mathrm{m}^{-2}\right) y r^{-1}\) |
Subtopic: Â Ecosystem Productivity |Â Energy Flow |
Level 3: 35%-60%
NEET - 2024
Hints
Which of the following are fused in somatic hybridization involving two varieties of plants?
| 1. | Somatic embryos | 2. | Protoplasts |
| 3. | Pollens | 4. | Callus |
Subtopic: Â Plant Tissue Culture |
 68%
Level 2: 60%+
NEET - 2024
Hints
Which of the following statement is correct regarding the process replication in E. coli ?
| 1. | The DNA dependent RNA polymerase catalyses polymerization in one direction, that is 5' \(\rightarrow\) 3' |
| 2. | The DNA dependent DNA polymerase catalyses polymerization in 5' \(\rightarrow\) 3' as well as the 3' \(\rightarrow\) 5' direction. |
| 3. | The DNA dependent DNA polymerase catalyses polymerization in 5' \(\rightarrow\) 3' direction. |
| 4. | The DNA dependent DNA polymerase catalyses polymerization in one direction which is 3' \(\rightarrow\) 5'. |
Subtopic: Â DNA Replication |
 55%
Level 3: 35%-60%
NEET - 2024
Hints
Given below are two statements: one is labelled as Assertion (A) and the other is labelled as Reason (R):
In the light of the above statements, choose the correct answer from the options given below:
| Assertion (A): | FSH acts upon ovarian follicles in female and Leydig cells in male. |
| Reason (R): | Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in human males . |
In the light of the above statements, choose the correct answer from the options given below:
| 1. | Both (A) and (R) are True but (R) is not the correct explanation of (A). |
| 2. | (A) is True but (R) is False |
| 3. | (A) is False but (R) is True |
| 4. | Both (A) and (R) are True and (R) is the correct explanation of (A). |
Subtopic: Â Male Reproductive System |Â Female Reproductive System-2 |
 54%
Level 3: 35%-60%
NEET - 2024
Hints
Which of the following are Autoimmune disorders?
A: Myasthenia gravis
B: Rheumatoid arthritis
C: Gout
D: Muscular dystrophy
E: Systemic Lupus Erythematosus (SLE)
Choose the most appropriate answer from the options given below:
A: Myasthenia gravis
B: Rheumatoid arthritis
C: Gout
D: Muscular dystrophy
E: Systemic Lupus Erythematosus (SLE)
Choose the most appropriate answer from the options given below:
| 1. | A, B, & E only | 2. | B, C & E only |
| 3. | C, D & E only | 4. | A, B & D only |
Subtopic: Â Allergies & Autoimmunity |
 61%
Level 2: 60%+
NEET - 2024
Hints
Given below are statements:
In the light of the above statements, choose the correct answer from the options given below:
1. Both Statement I and Statement II are False
2. Statement I is True but Statement II is False
3. Statement I is False but Statement II is True
4. Both Statement I and Statement II are True
| Statement I: | In the nephron, the descending limb of loop of Henle is impermeable to water and permeable to electrolytes. |
| Statement II: | The proximal convoluted tubule is lined by simple columnar brush border epithelium and increases the surface area for reabsorption. |
In the light of the above statements, choose the correct answer from the options given below:
1. Both Statement I and Statement II are False
2. Statement I is True but Statement II is False
3. Statement I is False but Statement II is True
4. Both Statement I and Statement II are True
Subtopic: Â Nephron Part 1 |Â Function of the tubules |
 51%
Level 3: 35%-60%
NEET - 2024
Hints
Which one is the correct product of DNA dependent RNA polymerase to the given template?
3'TACATGGCAAATATCCATTCA5'
1. 5'AUGUAAAGUUUAUAGGUAAGU3'
2. 5'AUGUACCGUUUAUAGGGAAGU3'
3. 5'ATGTACCGTTTATAGGTAAGT3'
4. 5'AUGUACCGUUUAUAGGUAAGU3'
3'TACATGGCAAATATCCATTCA5'
1. 5'AUGUAAAGUUUAUAGGUAAGU3'
2. 5'AUGUACCGUUUAUAGGGAAGU3'
3. 5'ATGTACCGTTTATAGGTAAGT3'
4. 5'AUGUACCGUUUAUAGGUAAGU3'
Subtopic: Â Transcription: I |
 55%
Level 3: 35%-60%
NEET - 2024
Hints
© 2026 GoodEd Technologies Pvt. Ltd.