Different species of a genus
| 1. | Are very different from each other in their basic properties |
| 2. | Have morphological similarities |
| 3. | Can be placed in different families |
| 4. | Cannot be differentiated on the basis of their morphological features |
Subtopic: Taxonomy 2: Classification up to Genus | Taxonomy 3: From Family to Classification of Some Organisms |
62%
Level 2: 60%+
Please attempt this question first.
Hints
Please attempt this question first.
Which of the following statements are correct?
Choose the correct answer from the options given below:
| A: | An excessive loss of body fluid from the body switches off osmoreceptors. |
| B: | ADH facilitates water reabsorption to prevent diuresis. |
| C: | ANF causes vasodilation. |
| D: | ADH causes increase in blood pressure. |
| E: | ADH is responsible for decrease in GFR. |
| 1. | C, D and E only | 2. | A and B only |
| 3. | B, C and D only | 4. | A, B and E only |
Subtopic: Osmoregulation | Disorders of Excretory System |
81%
Level 1: 80%+
NEET - 2023
Hints
Which of the following are not under the control of thyroid hormone?
Choose the correct answer from the options given below:
| A. | Maintenance of water and electrolyte balance. |
| B. | Regulation of basal metabolic rate. |
| C. | Normal rhythm of sleep-wake cycle. |
| D. | Development of immune system. |
| E. | Support the process of formation of RBCs. |
Choose the correct answer from the options given below:
| 1. | D and E only | 2. | A and D only |
| 3. | B and C only | 4. | C and D only |
Subtopic: Thyroid Gland Part I |
74%
Level 2: 60%+
NEET - 2023
Hints
The parts of the human brain that help in the regulation of sexual behavior, expression of excitement, pleasure, rage, fear, etc. are:
1. Corpus callosum and thalamus
2. Limbic system & hypothalamus
3. Corpora quadrigemina & hippocampus
4. Brain stem & epithalamus
1. Corpus callosum and thalamus
2. Limbic system & hypothalamus
3. Corpora quadrigemina & hippocampus
4. Brain stem & epithalamus
Subtopic: Diencephalon |
90%
Level 1: 80%+
NEET - 2023
Hints
Match List-I with List-II.
Choose the correct answer from the options given below:
| List-I | List-II | ||
| A. | Logistic growth | I. | Unlimited resource availability condition |
| B. | Exponential growth | II. | Limited resource availability condition |
| C. | Expanding age pyramid | III. | The percent individuals of pre-reproductive age is largest followed by reproductive and post reproductive age groups |
| D. | Stable age pyramid | IV. | The percent individuals of pre-reproductives and reproductive age group are same |
| Options: | A | B | C | D |
| 1. | II | IV | III | I |
| 2. | II | I | III | IV |
| 3. | II | III | I | IV |
| 4. | II | IV | I | III |
Subtopic: Population: Exponential Growth Model | Population: Logistic Growth Model | Age Pyramid |
93%
Level 1: 80%+
NEET - 2023
Hints
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows
5'AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'?
5'AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'?
| 1. | 3' ATCGATCGATCGATCGATCGATCGATCG 5' |
| 2. | 5' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3' |
| 3. | 3' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5' |
| 4. | 5' ATCGATCGATCGATCGATCGATCGATCG 3' |
Subtopic: Transcription: I | Transcription:II | Transcription: III | Transcription: IV | Transcription |
51%
Level 3: 35%-60%
NEET - 2023
Hints
Which of the following is the characteristic
feature of cockroach regarding sexual dimorphism?
1. Presence of anal cerci
2. Dark brown body colour and anal cerci
3. Presence of anal styles
4. Presence of sclerites
feature of cockroach regarding sexual dimorphism?
1. Presence of anal cerci
2. Dark brown body colour and anal cerci
3. Presence of anal styles
4. Presence of sclerites
Subtopic: Cockroach:Male Reproductive System |
76%
Level 2: 60%+
NEET - 2023
Hints
Match List-I with List-II.
Choose the correct answer from the options given below:
| List-I | List-II | ||
| A. | Mast cells | I. | Ciliated epithelium |
| B. | Inner surface of bronchiole | II. | Areolar connective tissue |
| C. | Blood | III. | Cuboidal epithelium |
| D. | Tubular parts of nephron | IV. | Specialised connective tissue |
Choose the correct answer from the options given below:
| Options: | A | B | C | D |
| 1. | III | IV | II | I |
| 2. | I | II | IV | III |
| 3. | II | III | I | IV |
| 4. | II | I | IV | III |
Subtopic: Introduction to Animal & Epithelium Tissue | Connective Tissue |
83%
Level 1: 80%+
NEET - 2023
Hints
The unique mammalian characteristics are:
1. pinna, monocondylic skull and mammary glands
2. hairs, tympanic membrane and mammary glands
3. hairs, pinna and mammary glands
4. hairs, pinna and indirect development
1. pinna, monocondylic skull and mammary glands
2. hairs, tympanic membrane and mammary glands
3. hairs, pinna and mammary glands
4. hairs, pinna and indirect development
Subtopic: Study of Aves & Mammals |
82%
Level 1: 80%+
NEET - 2023
Hints
In cockroach, excretion is brought about by:
Choose the correct answer from the options given below:
| A. | Phallic gland |
| B. | Urecose gland |
| C. | Nephrocytes |
| D. | Fat body |
| E. | Collaterial glands |
Choose the correct answer from the options given below:
| 1. | B and D only | 2. | A and E only |
| 3. | A, B and E only | 4. | B, C and D only |
Subtopic: Cockroach: Excretory System |
75%
Level 2: 60%+
NEET - 2023
Hints
© 2026 GoodEd Technologies Pvt. Ltd.