PHYSICS
1. For Young's double-slit experiment, two statements are given below:
| Statement I: |
If screen is moved away from the plane of slits, angular separation of the fringes remains constant. |
| Statement Ii: |
If the monochromatic source is replaced by another monochromatic source of larger wavelength, the angular separation of fringes decreases. |
| 1. |
Statement I is False but Statement II is True. |
| 2. |
Both Statement I and Statement II are True. |
| 3. |
Both Statement I and Statement II are False. |
| 4. |
Statement I is True but Statement II is False. |
2. The ratio of frequencies of fundamental harmonic produced by an open pipe to that of closed pipe having the same length is:
| 1. |
\(3:1\) |
2. |
\(1:2\) |
| 3. |
\(2:1\) |
4. |
\(1:3\) |
3. The ratio of the radius of gyration of a solid sphere of mass \(M\) and radius \(R\) about its own axis to the radius of gyration of the thin hollow sphere of the same mass and radius about its axis is:
1. \(5:2\)
2. \(3:5\)
3. \(5:3\)
4. \(2:5\)
4. An AC source is connected to a capacitor
\(C\). Due to decrease in its operating frequency:
| 1. |
capacitive reactance remains constant |
| 2. |
capacitive reactance decreases. |
| 3. |
displacement current increases. |
| 4. |
displacement current decreases. |
5. In hydrogen spectrum, the shortest wavelength in the Balmer series is \(\lambda\). The shortest wavelength in the Bracket series is:
1. \(16\lambda\)
2. \(2\lambda\)
3. \(4\lambda\)
4. \(9\lambda\)
6. A vehicle travels half the distance with speed
\(v\) and the remaining distance with speed
\(2v.\) Its average speed is:
| 1. |
\(\dfrac{3v}{4}\) |
2. |
\(\dfrac{v}{3}\) |
| 3. |
\(\dfrac{2v}{3}\) |
4. |
\(\dfrac{4v}{3}\) |
7. The potential energy of a long spring when stretched by
\(2~\text{cm}\) is
\(U.\) If the spring is stretched by
\(8~\text{cm},\) the potential energy stored in it will be:
| 1. |
\(16U\) |
2. |
\(2U\) |
| 3. |
\(4U\) |
4. |
\(8U\) |
8. A bullet is fired from a gun at the speed of
\(280~\text{ms}^{-1}\) in the direction
\(30^\circ\) above the horizontal. The maximum height attained by the bullet is:
\(\left(g=9.8~\text{m/s}^{2}, \sin30^{\circ}=0.5\right)\)
| 1. |
\(3000~\text{m}\) |
2. |
\(2800~\text{m}\) |
| 3. |
\(2000~\text{m}\) |
4. |
\(1000~\text{m}\) |
9. The net magnetic flux through any closed surface is:
| 1. |
negative |
2. |
zero |
| 3. |
positive |
4. |
infinity |
10. A metal wire has mass \((0.4\pm 0.002)~\text{g}\), radius \((0.3\pm 0.001)~\text{mm}\) and length \((5\pm 0.02)~\text{cm}\). The maximum possible percentage error in the measurement of density will nearly be:
1. \(1.4 \%\)
2. \(1.2 \%\)
3. \(1.3 \%\)
4. \(1.6 \%\)
11. The angular acceleration of a body moving along the circumference of a circle is:
| 1. |
along the axis of rotation |
| 2. |
along the radius, away from the centre |
| 3. |
along the radius towards the centre |
| 4. |
along the tangent to its position |
12. The magnetic energy stored in an inductor of inductance \(4~\mu\text{H}\) carrying a current of \(2~\text{A}\) is:
1. \(8~\mu \text{J}\)
2. \(4~\mu \text{J}\)
3. \(4~\text{mJ}\)
4. \(8~\text{mJ}\)
13. A full wave rectifier circuit consists of two \(\mathrm{p\text-n}\) junction diodes, a centre-tapped transformer, capacitor and a load resistance. Which of these components remove the ac ripple from the rectified output?
1. load resistance
2. a centre-tapped transformer
3. \(\mathrm{p\text-n}\) junction diodes
4. capacitor
14. A football player is moving southward and suddenly turns eastward with the same speed to avoid an opponent. The force that acts on the player while turning is:
| 1. |
along south-west |
2. |
along eastward |
| 3. |
along northward |
4. |
along north-east |
15. The work functions of Caesium
\((\mathrm{Cs}),\) Potassium
\((\mathrm{K}),\) and Sodium
\((\mathrm{Na})\) are
\(2.14~\text{eV},\) \(2.30~\text{eV}\) and
\(2.75~\text{eV}\) respectively. If incident electromagnetic radiation has an incident energy of
\(2.20~\text{eV},\) which of these photosensitive surfaces may emit photoelectrons?
| 1. |
\(\mathrm{Na}\) only |
2. |
\(\mathrm{Cs}\) only |
| 3. |
both \(\mathrm{Na}\) and \(\mathrm{K}\) |
4. |
\(\mathrm{K}\) only |
16. If
\(\oint_s \vec{E} \cdot {d \vec S}=0\) over a surface, then:
| 1. |
the electric field inside the surface is necessarily uniform. |
| 2. |
the number of flux lines entering the surface must be equal to the number of flux lines leaving it. |
| 3. |
the magnitude of electric field on the surface is constant. |
| 4. |
all the charges must necessarily be inside the surface. |
17. Given below are two statements:
| Statement I: |
Photovoltaic devices can convert optical radiation into electricity. |
| Statement II: |
The Zener diode is designed to operate under reverse bias in the breakdown. |
| 1. |
Statement I is incorrect but Statement II is correct. |
| 2. |
Both Statement I and Statement II are correct. |
| 3. |
Both Statement I and Statement II are incorrect. |
| 4. |
Statement I is correct but Statement II is incorrect. |
18. In a plane electromagnetic wave travelling in free space, the electric field component oscillates sinusoidally at a frequency of \(2.0\times 10^{10}~ \text{Hz}\) and amplitude \(48~\text{Vm}^{-1}\). Then the amplitude of the oscillating magnetic field is: (Speed of light in free space \(3\times 10^{8}~ \text{ms}^{-1}\))
1. \(1.6 \times 10^{-6} ~\text{T}\)
2. \(1.6 \times 10^{-9} ~\text{T}\)
3. \(1.6 \times 10^{-8} ~\text{T}\)
4. \(1.6 \times 10^{-7} ~\text{T}\)
19. The temperature of a gas is \(-50^\circ \text{C}.\) To what temperature the gas should be heated so that the RMS speed is increased by \(3\) times?
1. \(223~\text{K}\)
2. \(669^\circ \text{C}\)
3. \(3295^\circ \text{C}\)
4. \(3097~\text{K}\)
20. The magnitude and direction of the current in the following circuit is:
| 1. |
\(1.5~\text{A}\) from \({B}\) to \({A}\) through \(E\) |
| 2. |
\(0.2~\text{A}\) from \({B}\) to \({A}\) through \(E\) |
| 3. |
\(0.5~\text{A}\) from \({A}\) to \({B}\) through \(E\) |
| 4. |
\(\dfrac{5}{9}~\text{A}\) from \({A}\) to \({B}\) through \(E\) |
21. An electric dipole is placed at an angle of
\(30^\circ\) with an electric field of intensity
\(2\times 10^5 ~\text{NC}^{-1}\). It experiences a torque equal to
\(4~\text{N-m}\). If the dipole length is
\(2\) cm, calculate the magnitude of the charge on the dipole.
| 1. |
\(2~\text{mC}\) |
2. |
\(8~\text{mC}\) |
| 3. |
\(6~\text{mC}\) |
4. |
\(4~\text{mC}\) |
22. Let a wire be suspended from the ceiling (rigid support) and stretched by a weight
\(W\) attached at its free end. The longitudinal stress at any point of the cross-sectional area
\(A\) of the wire is:
| 1. |
zero |
2. |
\(\frac{2W}{A}\) |
| 3. |
\(\frac{W}{A}\) |
4. |
\(\frac{W}{2A}\) |
23. The equivalent capacitance of the system shown in the following circuit is:
| 1. |
\(9~{\mu \text{F}}\) |
2. |
\(2~{\mu \text{F}}\) |
| 3. |
\(3~{\mu \text{F}}\) |
4. |
\(6~{\mu \text{F}}\) |
24. The venturi-meter works on:
| 1. |
The principle of perpendicular axes |
| 2. |
Huygen's principle |
| 3. |
Bernoulli's principle |
| 4. |
The principle of parallel axes |
25. In a series
\({LCR}\) circuit, the inductance
\({L}\) is
\(10~\text{mH}\), capacitance
\({C}\) is
\(1~\mu\text{F}\) and resistance
\({R}\) is
\(100~\Omega\). The frequency at which resonance occurs is:
| 1. |
\(1.59~\text{kHz}\) |
2. |
\(15.9~\text{rad/s}\) |
| 3. |
\(15.9~\text{kHz}\) |
4. |
\(1.59~\text{rad/s}\) |
26. Two bodies of mass
\(m\) and
\(9m\) are placed at a distance
\(R.\) The gravitational potential on the line joining the bodies where the gravitational field equals zero, will be:
(
\(G=\) gravitational constant)
| 1. |
\(-\dfrac{20~Gm}{R}\) |
2. |
\(-\dfrac{8~Gm}{R}\) |
| 3. |
\(-\dfrac{12~Gm}{R}\) |
4. |
\(-\dfrac{16~Gm}{R}\) |
27. Light travels a distance
\(x\) in time
\(t_1\) in air and
\(10x\) in time
\(t_2\) in another denser medium. What is the critical angle for this medium?
| 1. |
\(\sin ^{-1}\left(\frac{10 t_1}{t_2}\right) \) |
2. |
\(\sin ^{-1}\left(\frac{ t_2}{t_1}\right) \) |
| 3. |
\(\sin ^{-1}\left(\frac{10 t_2}{t_1}\right) \) |
4. |
\(\sin ^{-1}\left(\frac{ t_1}{10t_2}\right) \) |
28. The amount of energy required to form a soap bubble of radius \(2~\text{cm}\) from a soap solution is nearly:
\((\)the surface tension of soap solution \(0.03~\text{Nm}^{-1})\)
1. \(50.1 \times 10^{-4}~\text{J}\)
2. \(30.16 \times 10^{-4}~ \text{J}\)
3. \(5.06 \times 10^{-4} ~\text{J}\)
4. \(3.01\times 10^{-4} ~\text{J}\)
29. If the galvanometer
\(G\) does not show any deflection in the circuit shown, the value of
\(R\) is given by;
| 1. |
\(400~\Omega\) |
2. |
\(200~\Omega\) |
| 3. |
\(50~\Omega\) |
4. |
\(100~\Omega\) |
30. The errors in the measurement which arise due to unpredictable fluctuations in temperature and voltage supply are:
| 1. |
Random errors |
2. |
Instrumental errors |
| 3. |
Personal errors |
4. |
Least count errors |
31. A wire carrying a current \(I\) along the positive \(x\)-axis has length \(L\). It is kept in a magnetic field \(\overrightarrow{B}=(2 \hat{i}+3 \hat{j}-4 \hat{k})~\text{T}\). The magnitude of the magnetic force acting on the wire is:
1. \(\sqrt{3}IL\)
2. \(3IL\)
3. \(\sqrt{5}IL\)
4. \(5IL\)
32. A very long conducting wire is bent in a semi-circular shape from
\(A\) to
\(B\) as shown in the figure. The magnetic field at the point
\(P\) for steady current configuration is given by:
| 1. |
\(\dfrac{\mu_0 i}{4 R}\left[1-\dfrac{2}{\pi}\right]\) pointed into the page |
| 2. |
\(\dfrac{\mu_0 i}{4 R}\) pointed into the page |
| 3. |
\(\dfrac{\mu_0 i}{4 R}\) pointed away from the page |
| 4. |
\(\dfrac{\mu_0 i}{4 R}\left[1-\dfrac{2}{\pi}\right]\) pointed away from the page |
33. A bullet from a gun is fired on a rectangular wooden block with velocity
\(u\). When bullet travels
\(24\) cm through the block along its length horizontally, velocity of bullet becomes
\(u/3\). Then it further penetrates into the block in the same direction before coming to rest exactly at the other end of the block. The total length of the block is:
| 1. |
\(30\) cm |
2. |
\(27\) cm |
| 3. |
\(24\) cm |
4. |
\(28\) cm |
34. An electric dipole is placed as shown in the figure.

The electric potential (in
\(10^2~\text{V}\)) at the point
\(P\) due to the dipole is:
(
\(\varepsilon_0=\) permittivity of free space and
\(\dfrac{1}{4 \pi \varepsilon_0}=k\))
| 1. |
\(\left(\dfrac{8}{3}\right)qk\) |
2. |
\(\left(\dfrac{3}{8}\right)qk \) |
| 3. |
\(\left(\dfrac{5}{8}\right)qk\) |
4. |
\(\left(\dfrac{8}{5}\right)qk\) |
35. In the figure shown here, what is the equivalent focal length of the combination of lenses?
(Assume that all layers are thin)
| 1. |
\(-50~\text{cm}\) |
2. |
\(40~\text{cm}\) |
| 3. |
\(-40~\text{cm}\) |
4. |
\(-100~\text{cm}\) |
36. A satellite is orbiting just above the surface of the earth with period
\(T.\) If
\(d\) is the density of the earth and
\(G\) is the universal constant of gravitation, the quantity
\(\dfrac{3 \pi}{G d}\) represents:
| 1. |
\(\sqrt{T}\) |
2. |
\(T\) |
| 3. |
\(T^2\) |
4. |
\(T^3\) |
37. \(10\) resistors, each of resistance
\(R\) are connected in series to a battery of
\(E\) and negligible internal resistance. Then those are connected in parallel to the same battery, the current is increased
\(n\) times. The value of
\(n\) is:
| 1. |
\(1000\) |
2. |
\(10\) |
| 3. |
\(100\) |
4. |
\(1\) |
38. A horizontal bridge is built across a river. A student standing on the bridge throws a small ball vertically upwards with a velocity
\(4\) ms
–1. The ball strikes the water surface after
\(4\) s. The height of bridge above water surface is:
(Take
\(g=10~ \text {ms}^{-2}\) )
| 1. |
\(68\) m |
2. |
\(56\) m |
| 3. |
\(60\) m |
4. |
\(64\) m |
39. Two thin lenses are of the same focal lengths \((f),\) but one is convex and the other one is concave. When they are placed in contact with each other, the equivalent focal length of the combination will be:
1. infinite
2. zero
3. \(f/4\)
4. \(f/2\)
40. The radius of innermost orbit of a hydrogen atom is
\(5.3 \times 10^{-11}~\text m.\) What is the radius of the third allowed orbit of a hydrogen atom?
| 1. |
\(4.77~ \mathring{A}\) |
2. |
\(0.53~ \mathring{A}\) |
| 3. |
\(1.06~ \mathring{A}\) |
4. |
\(1.59~ \mathring{A}\) |
41. The resistance of platinum wire at \(0^{\circ} \text{C}\) is \(2~ \Omega\) and \(6.8~ \Omega\) at \(80^{\circ}\text{C}\). The temperature coefficient of resistance of the wire is:
1. \(3\times 10^{-1}~^\circ \text{C}^{-1}\)
2. \(3 \times 10^{-4}~^\circ \text{C}^{-1}\)
3. \(3 \times 10^{-3}~^\circ \text{C}^{-1}\)
4. \(3 \times 10^{-2}~^\circ \text{C}^{-1}\)
42. The net impedance of the circuit (as shown in the figure) will be:
| 1. |
\(25~\Omega\) |
2. |
\(10\sqrt{2}~\Omega\) |
| 3. |
\(15~\Omega\) |
4. |
\(5\sqrt{5}~\Omega\) |
43. Calculate the maximum acceleration of a moving car so that a body lying on the floor of the car remains stationary. The coefficient of static friction between the body and the floor is
\(0.15\). (take
\(g=10\) ms
–2)
| 1. |
\(50\) ms–2 |
2. |
\(1.2\) ms–2 |
| 3. |
\(150\) ms–2 |
4. |
\(1.5\) ms–2 |
44. For the following logic gate, the truth table is:
| 1. |
| \(\mathrm A\) |
\(\mathrm B\) |
\(\mathrm C\) |
| \(0\) |
\(0\) |
\(0\) |
| \(0\) |
\(1\) |
\(0\) |
| \(1\) |
\(0\) |
\(0\) |
| \(1\) |
\(1\) |
\(1\) |
|
| 2. |
| \(\mathrm A\) |
\(\mathrm B\) |
\(\mathrm C\) |
| \(0\) |
\(0\) |
\(1\) |
| \(0\) |
\(1\) |
\(1\) |
| \(1\) |
\(0\) |
\(1\) |
| \(1\) |
\(1\) |
\(0\) |
|
| 3. |
| \(\mathrm A\) |
\(\mathrm B\) |
\(\mathrm C\) |
| \(0\) |
\(0\) |
\(0\) |
| \(0\) |
\(1\) |
\(1\) |
| \(1\) |
\(0\) |
\(1\) |
| \(1\) |
\(1\) |
\(1\) |
|
| 4. |
| \(\mathrm A\) |
\(\mathrm B\) |
\(\mathrm C\) |
| \(0\) |
\(0\) |
\(1\) |
| \(0\) |
\(1\) |
\(0\) |
| \(1\) |
\(0\) |
\(1\) |
| \(1\) |
\(1\) |
\(0\) |
|
45. The displacement-time
\((x\text-t)\) graph of a particle performing simple harmonic motion is shown in the figure. The acceleration of the particle at
\(t=2\) s is:
| 1. |
\(-\dfrac{\pi^2}{16} ~\text{ms}^{-2}\) |
2. |
\(\dfrac{\pi^2}{8}~ \text{ms}^{-2}\) |
| 3. |
\(-\dfrac{\pi^2}{8} ~\text{ms}^{-2}\) |
4. |
\(\dfrac{\pi^2}{16} ~\text{ms}^{-2}\) |
CHEMISTRY
46. The mass of CO
2 produced by heating 20 g of 20% pure limestone, as per the equation given below, is:
\(\mathrm{CaCO}_3(\mathrm{~s}) \xrightarrow{\text { heat }} \mathrm{CaO}(s)+\mathrm{CO}_2(\mathrm{~g})\)
| 1. |
1.32 g |
2. |
1.12 g |
| 3. |
1.76 g |
4. |
2.64 g |
47. Given below are two statements: one is labeled as Assertion (A) and the other is labeled as Reason (R):
| Assertion (A): |
Helium is used to dilute oxygen in the diving apparatus. |
| Reason (R): |
Helium has a high solubility in O2. |
In light of the above statements, choose the correct answer from the options given below:
| 1. |
(A) is False but (R) is True. |
| 2. |
Both (A) and (R) are True and (R) is the correct explanation of (A). |
| 3. |
Both (A) and (R) are True and (R) is not the correct explanation of (A). |
| 4. |
(A) is True but (R) is False. |
48. The correct order of energies of molecular orbitals of N
2 molecule is:
| 1. |
\( \sigma \text { 1s }<\sigma^* \text { 1s }<\sigma 2 s<\)
\(\sigma^* 2 s<\left(\pi 2 p_x=\pi 2 p_y\right)<\)
\(\left(\pi^* 2 p_x=\pi^* 2 p_y\right)<\sigma 2 p_z<\sigma^* 2 p_z\) |
| 2. |
\( \sigma \text { 1s }<\sigma^* \text { 1s }<\sigma 2 s<\sigma^* 2 s<\)
\(\left(\pi 2 p_x=\pi 2 p_y\right)< \)
\(\sigma 2 p_z<\left(\pi^* 2 p_x=\pi^* 2 p_y\right)<\sigma^* 2 p_z \) |
| 3. |
\( \sigma \text { 1s }<\sigma^* \text { 1s }<\sigma 2 s<\sigma^* 2 s<\sigma 2 p_z<\)
\( \left(\pi 2 p_x=\pi 2 p_y\right)<\)
\(\left(\pi^* 2 p_x=\pi^* 2 p_y\right)<\sigma^* 2 p_z \) |
| 4. |
\( \sigma \text { 1s }<\sigma^* \text { 1s }\)
\(<\sigma 2 s<\sigma^* 2 s<\sigma 2 p_z< \)
\( \sigma^* 2 p_z<\left(\pi 2 p_x=\pi 2 p_y\right)<\)
\(\left(\pi^* 2 p_x=\pi^* 2 p_y\right) \) |
49. Given below are two statements:
| Assertion (A): |
A reaction can have zero activation energy. |
| Reason (R): |
The minimum amount of energy required by reactant molecules so that their energy becomes equal to threshold value, is called activation energy. |
| 1. |
(A) is False but (R) is True. |
| 2. |
Both (A) and (R) are True and (R) is the correct explanation of (A) |
| 3. |
Both (A) and (R) are True but (R) is not the correct explanation of (A). |
| 4. |
(A) is True but (R) is False. |
50. Find out the weight (in g) of two moles of the organic compound, which is obtained by heating sodium ethanoate with sodium hydroxide in the presence of calcium oxide:
1. 18
2. 16
3. 32
4. 30
51. Given is a reaction for your reference:

The final product [C] is:
52. Select the correct statements from the following:
| A: |
Atoms of all elements are composed of two fundamental particles. |
| B: |
The mass of the electron is \(9.10939 \times 10^{-31} \mathrm{~kg} \text {. }\) |
| C: |
All the isotopes of a given element show the same chemical properties. |
| D: |
Protons and electrons are collectively known as nucleons. |
| E: |
Dalton's atomic theory regarded the atom as an ultimate particle of matter. |
Choose the correct answer from the options given below:
| 1. |
B, C and E only |
2. |
A, B and C only |
| 3. |
C, D and E only |
4. |
A and E only |
53. The stability of Cu2+ is greater than that of Cu+ salts in an aqueous solution due to:
1. Second ionisation enthalpy
2. First ionisation enthalpy
3. Enthalpy of atomization
4. Hydration energy
54. The relation between
\(n_m \) (
\(n_m \) = number of permissible values of magnetic quantum number (m
l) for a given value of azimuthal quantum number (l) is:
| 1. |
\(n_m = l+2\) |
2. |
\(l = {\dfrac{n_m -1} 2}\) |
| 3. |
\(l= 2n_m +1\) |
4. |
\(n_m = 2l^2 + 1 \) |
55. Homoleptic complex from the following complexes is:
1. Triamminetriaquachromium (III)
2. Potassium trioxalatoaluminate (III)
3. Diamminechloridonitrito-N-platinum (II)
4. Pentaamminecarbonatocobalt (III) chloride
56. Among the given reactions, which one does not result in the formation of a primary amine as the product?
57. On heating, some solid substances change from solid to vapour state without passing through liquid state. The technique used for the purification of such solid substances based on the above principle is known as:
| 1. |
Sublimation |
2. |
Distillation |
| 3. |
Chromatography |
4. |
Crystallization |
58. Amongst the given option which of the following molecules/ion acts as a Lewis acid?
1. \(\text{OH}^- \)
2. \(\text{NH}_3 \)
3. \(\text H_2 \text O \)
4. \(\text{BF}_3 \)
59. Match the allotropes of carbon given in List I with the respective characteristics given in List II:
|
List-I |
|
List-II |
| A. |
Coke |
I. |
Carbon atoms are sp3 hybridised. |
| B. |
Diamond |
II. |
Used as a dry lubricant |
| C. |
Fullerene |
III. |
Used as a reducing agent |
| D. |
Graphite |
IV. |
Cage like molecules |
Choose the correct answer from the options given below:
| Options: |
(A) |
(B) |
(C) |
(D) |
| 1. |
III |
IV |
I |
II |
| 2. |
II |
IV |
I |
III |
| 3. |
IV |
I |
II |
III |
| 4. |
III |
I |
IV |
II |
60. The element expected to form the largest ion to achieve the nearest noble gas configuration is:
| 1. |
Sodium(Na) |
2. |
Oxygen(O) |
| 3. |
Fluorine(F) |
4. |
Nitrogen(N) |
61. Given below are two statements:
| Statement I: |
A unit formed by the attachment of a base to 1' position of sugar is known as a nucleoside. |
| Statement II: |
When nucleoside is linked to a phosphorous acid at 5' position of sugar moiety, we get nucleotide. |
In the light of the above statements choose the correct answer from the options given below:
| 1. |
Statement I is false but Statement II is true. |
| 2. |
Both Statement I and Statement II are true. |
| 3. |
Both Statement I and Statement II are false. |
| 4. |
Statement I is true but Statement II is false. |
62. The following compound would be classified as:
| 1. |
Vinylic halide |
2. |
Benzylic halide |
| 3. |
Aryl halide |
4. |
Allylic halide |
63. In Lassaigne's extract of an organic compound, both nitrogen and sulphur are present, which gives blood red colour with \(\text{Fe}^{3+}\) due to the formation of:
1. \([\mathrm{Fe}(\mathrm{SCN})]^{2+} \)
2. \(\mathrm{Fe}_4\left[\mathrm{Fe}(\mathrm{CN})_6\right]_3 \cdot \mathrm{xH}_2 \mathrm{O} \)
3. \(\mathrm{NaSCN} \)
4. \(\left[\mathrm{Fe}(\mathrm{CN})_5 \mathrm{NOS}\right]^{4-} \)
64. Given below are two statements:
| Assertion (A): |
In the equation, \(\Delta_{\mathrm{r}} \mathrm{G}=-\mathrm{nFE} _{\text {cell }}, \) value of \(\mathrm{\Delta_rG }\) depends on n. |
| Reason (R): |
\(\mathrm{E_{cell} }\) is an intensive property and \(\mathrm{\Delta_rG }\) is an extensive property. |
| 1. |
(A) is False, but (R) is True. |
| 2. |
Both (A) and (R) are True and (R) is the correct explanation of (A). |
| 3. |
Both (A) and (R) are True and (R) is not the correct explanation of (A). |
| 4. |
(A) is True, but (R) is False. |
65. Given the following five species:
\(\mathrm{NH}_3, \mathrm{AlCl}_3, \mathrm{BeCl}_2, \mathrm{CCl}_4, \mathrm{PCl}_5 \)
The total number of these species that do not have eight electrons around the central atom in its/their outermost shell, is/are:
| 1. |
One |
2. |
Three |
| 3. |
Two |
4. |
Four |
66. Identify the product in the following reaction:
67. The conductivity of centimolar solution of KCl at 25°C is 0.0210 ohm
–1 cm
–1 and the resistance of the cell containing the solution at 25°C is 60 ohm. The value of the cell constant is:
| 1. |
3.34 cm–1 |
2. |
1.34 cm–1 |
| 3. |
3.28 cm–1 |
4. |
1.26 cm–1 |
68. The number of \(\sigma\) bonds, \(\pi\) bonds and lone pair of electrons in pyridine, respectively, are:
1. 12, 2, 1
2. 11, 2, 0
3. 12, 3, 0
4. 11, 3, 1
69. Identify the correct relationship of stability from the options provided:
| 1. |
\(\mathrm{TlI > TlI_3}\) |
2. |
\(\mathrm{TlCl_3 > TlCl}\) |
| 3. |
\(\mathrm{InI_3 > InI }\) |
4. |
\(\mathrm{AlCl > AlCl_3 }\) |
70. Identify the product (A) in the following reaction:
71. Match
List-I with
List-II.
|
List-I
(Compound) |
|
List-II
(Shape/geometry) |
| A. |
NH3 |
I. |
Trigonal Pyramidal |
| B. |
BrF5 |
II. |
Square planar |
| C. |
XeF4 |
III. |
Octahedral |
| D. |
SF6 |
IV. |
Square Pyramidal |
Choose the correct answer from the option given below:
| 1. |
A-II, B-IV, C-III, D-I |
2. |
A-III, B-IV, C-I, D-II |
| 3. |
A-II, B-III, C-IV, D-I |
4. |
A-I, B-IV, C-II, D-III |
72. For a certain reaction, the rate =
\(k[A]^2[B],\) when the initial concentration of A is tripled keeping the concentration of B constant, the initial rate would be:
| 1. |
Increase by a factor of three |
| 2. |
Decrease by a factor of nine |
| 3. |
Increase by a factor of six |
| 4. |
Increase by a factor of nine |
73. Consider the following reaction and identify the product (P):
74. What is the correct relationship between changes in enthalpy and internal energy within the following options?
1. \(\mathrm{\Delta {H}+\Delta {U}=\Delta {nR}} \)
2. \(\mathrm{\Delta {H}=\Delta {U -\Delta n_gRT}}\)
3. \(\mathrm{\Delta {H}=\Delta {U+\Delta n_gRT }}\)
4. \(\mathrm{\Delta {H} -\Delta {U=-\Delta n_gRT}}\)
75. The equilibrium concentration of the species in the reaction
\(A+B \rightleftharpoons C+D\) are 2, 3, 10 and 6 mol L
–1, respectively at 300 K.
\(\Delta G^o\) for the reaction is:
(R = 2 cal/mol K)
| 1. |
–13.73 cal |
2. |
1372.60 cal |
| 3. |
–137.26 cal |
4. |
–1381.80 cal |
76. Identify the major product obtained in the following reaction:
77. A compound X contains 32% of A, 20% of B and remaining percentage of C. Then, the empirical formula of X is :
(Given atomic mass of A = 64; B = 40; C = 32u)
1. ABC3
2. AB2C2
3. ABC4
4. A2BC2
78. For the given redox reaction, find out the coefficients a, b and c of a balanced equation respectively:
\(\mathrm{{a} {Cr}_2 {O}_7^{2-}+{bSO}_3^{2-}({aq})+{c} {H}^{+}({aq})} →\)\(\mathrm{2 {a} {Cr}^{3+}({aq})+{bSO}_4^{2-}({aq})+\frac{{c}}{2} {H}_2 {O}(\ell)} \)
| 1. |
8, 1 and 3 |
2. |
1, 3 and 8 |
| 3. |
3, 8 and 1 |
4. |
1, 8 and 3 |
79. Match
List-I with
List-II:
|
(List-I)
Solid salt treated with dil. \(\mathrm{{H}_2 {SO}_4}\) |
|
(List-II )
Anion detected |
| A. |
Effervescence of colourless gas |
I. |
\( \mathrm{NO}_2^{-} \) |
| B. |
Gas with smell of rotten egg |
II. |
\(\mathrm{CO}_3^{2-} \) |
| C. |
Gas with pungent smell |
III. |
\(\mathrm{S}^{2-}\) |
| D. |
Brown fumes |
IV. |
\(\mathrm{SO}_3^{2-}\) |
Choose the correct answer from the options given below:
| 1. |
A-II, B-III, C-IV, D-I |
2. |
A-IV, B-III, C-II, D-I |
| 3. |
A-I, B-II, C-III, D-IV |
4. |
A-II, B-III, C-I, D-IV |
80. Consider the following reaction in a sealed vessel at equilibrium:
\(2 \text{NO}_{(\text{g})} \rightleftharpoons \text{N}_{2(\text{g})} +\text{O}_{2\text{(g)}}\)
[Given: \(\text{N}_2=3.0 \times 10^{-3} \text{M}, \text{O}_2=4.2 \times 10^{-3} \text{M}\) and \(\text{NO}=2.8 \times 10^{-3} \text M\)]
If 0.1 mol L-1 of NO(g) is taken in a closed vessel, what will be the degree of dissociation (\(\alpha\)) of NO(g) at equilibrium?
1. 0.0889
2. 0.00717
3. 0.717
4. 0.00889
81. The ratio of solubility of
\(\mathrm{AgCl}\) in
\(0.1~ \mathrm{M} ~\mathrm{KCl}\) solution to the solubility of
\( \mathrm{Ag} \mathrm{Cl}\) in water is:
(Given: Solubility product of
\(\mathrm{AgCl}=10^{-10}\) )
| 1. |
\(10^{-4}\) |
2. |
\(10^{-6}\) |
| 3. |
\(10^{-9}\) |
4. |
\(10^{-5}\) |
82. Which amongst the following will be most readily dehydrated under acidic conditions?
83. Match the Oxoacids of Sulphur given in
List-I with the number of bonds given in
List-II and mark the correct option:
|
List-I
(Oxoacids of Sulphur) |
|
List-II
(Bonds) |
| A. |
Peroxodisulphuric acid |
I. |
Two S-OH, Four S=O, One S-O-S |
| B. |
Sulphuric acid |
II. |
Two S-OH, One S=O |
| C. |
Pyrosulphuric acid |
III. |
Two S-OH, Four S=O, One S-O-O-S |
| D. |
Sulphurous acid |
IV. |
Two S-OH, Two S=O |
Choose the correct answer from the options given below:
| Options: |
A |
B |
C |
D |
| 1. |
III |
IV |
II |
I |
| 2. |
I |
III |
II |
IV |
| 3. |
III |
IV |
I |
II |
| 4. |
I |
III |
IV |
II |
85. The most stable compound, among the following, is:
1. [Co(NH3)6]2(SO4)3
2. [Co(NH3)4(H2O)Br](NO3)2
3. [Co(NH3)3(NO3)3]
4. [CoCl2(en)2]NO3
86. Consider the following reaction:

Identify products A and B:
87. Given below are two statements :
| Statement I: |
\(\left[\mathrm{Co}\left(\mathrm{NH}_3\right)_6\right]^{3+}\) is a homoleptic complex, whereas \([Co(NH_3)_4 Cl_2]^+\) is a heteroleptic complex. |
| Statement II: |
Complex \([Co(NH_3)_6]^{3+}\) has only one kind of ligand but \([Co(NH_3)_4 Cl_2]^+\) has more than one kind of ligands. |
In light of the above statements, choose the correct answer from the options given below:
1. Both
Statement I and
Statement II are False.
2.
Statement I is True but
Statement II is False.
3.
Statement I is false but
Statement II is True.
4. Both
Statement I and
Statement II are True.
88. Which of the following statements is incorrect?
| A. |
All the transition metals except scandium form MO oxides which are ionic. |
| B. |
The highest oxidation number corresponds to the group number
in transition metal oxides is attained in Sc2O3 to Mn2O7. |
| C. |
Basic character increases from V2O3 to V2O4 to V2O5. |
| D. |
V2O4 dissolves in acids to give VO43-. |
| E. |
CrO is basic, but Cr2O3 is amphoteric. |
Choose the correct answer from the options given below:
| 1. |
B and C only |
2. |
A and E only |
| 3. |
B and D only |
4. |
C and D only |
89. Consider the following compounds/species:
The number of compounds/species which obey Huckel's rule is:
90. The stabilization of a carbocation by an attached methyl group is primarily due to:
| 1. |
-I inductive effect |
2. |
Electromeric effect |
| 3. |
Hyperconjugation |
4. |
Mesomeric effect |
BIOLOGY
91. Unequivocal proof that DNA is the genetic material was first proposed by:
1. Wilkins and Franklin
2. Frederick Griffith
3. Alfred Hershey and Martha Chase
4. Avery, Macleod and McCarthy
92. Give below are two statements :
| Statement I: |
Endarch and exarch are the terms often used for describing the position of secondary xylem in the plant body. |
| Statement II: |
Exarch condition is the most common feature of the root system. |
In the light of the above statements, choose the correct answer from the options given below:
| 1. |
Statement I is incorrect but Statement II is correct. |
| 2. |
Both Statement I and Statement II are correct. |
| 3. |
Both Statement I and Statement II are incorrect. |
| 4. |
Statement I is correct but Statement II is incorrect. |
93. Cellulose does not form blue colour with iodine because
| 1. |
It breaks down when iodine reacts with it. |
| 2. |
It is a disaccharide. |
| 3. |
It is a helical molecule. |
| 4. |
It does not contain complex helices and hence cannot hold iodine molecules. |
94. Family Fabaceae differs from Solanaceae and Liliaceae. With respect to the stamens, pick out the characteristics specific to family Fabaceae but not found in Solanaceae or Liliaceae.
| 1. |
Epiphyllous and Dithecous anthers |
| 2. |
Diadelphous and Dithecous anthers |
| 3. |
Polyadelphous and epipetalous stamens |
| 4. |
Monoadelphous and Monothecous anthers |
95. The reaction centre in PS II has an absorption maxima at:
| 1. |
780 nm |
2. |
680 nm |
| 3. |
700 nm |
4. |
660 nm |
96. Upon exposure to UV radiation, DNA stained with ethidium bromide will show:
| 1. |
Bright orange colour |
2. |
Bright red colour |
| 3. |
Bright Blue colour |
4. |
Bright yellow colour |
97. The phenomenon of pleiotropism refers to:
| 1. |
more than two genes affecting a single character. |
| 2. |
presence of several alleles of a single gene controlling a single crossover. |
| 3. |
presence of two alleles, each of the two genes controlling a single trait. |
| 4. |
a single gene affecting multiple phenotypic expressions. |
98. The historic Convention on Biological Diversity, 'The Earth Summit' was held in Rio de Janeiro in the year :
99. During the purification process for recombinant DNA technology, addition of chilled ethanol precipitates out:
| 1. |
Polysaccharides |
2. |
RNA |
| 3. |
DNA |
4. |
Histones |
100. Frequency of recombination between gene pairs on same chromosome as a measure of the distance between genes to map their position on chromosome, was used for the first time by:
| 1. | Henking | 2. | Thomas Hunt Morgan |
| 3. | Sutton and Boveri | 4. | Alfred Sturtevant |
101. Given below are two statements : One is labelled as
Assertion (A) and the other is labelled
Reason (R):
| Assertion (A): |
The first stage of gametophyte in the life cycle of moss is protonema stage. |
| Reason (R): |
Protonema develops directly from spores produced in capsule. |
In the light of the above statements, choose the most appropriate answer from the options given below:
| 1. |
(A) is False but (R) is True. |
| 2. |
Both (A) and (R) are True and (R) is the correct explanation of (A). |
| 3. |
Both (A) and (R) are True but (R) is not the correct explanation of (A). |
| 4. |
(A) is True but (R) is False. |
102. Among eukaryotes, replication of DNA takes place in:
| 1. |
G2 Phase |
| 2. |
M phase |
| 3. |
S phase |
| 4. |
G1 phase |
103. What is the function of the ears in the corn cob?
| 1. |
To protect seeds |
2. |
To attract insects |
| 3. |
To trap pollen grains |
4. |
To disperse pollen grains |
104. In the equation

GPP is Gross Primary Productivity. NPP is net Primary Productivity. R here is ___________
1. Reproductive allocation
2. Photosynthetically active radiation
3. Respiratory quotient
4. Respiratory loss
105. Which hormone promotes internode / petiole elongation in deep water rice?
| 1. |
2, 4-D |
2. |
GA3 |
| 3. |
Kinetin |
4. |
Ethylene |
106. Axile placentation is observed in:
1. China rose, Petunia and Lemon
2. Mustard, Cucumber and Primrose
3. China rose, Beans and Lupin
4. Tomato, Dianthus and Pea
107. The process of appearance of recombination nodules occurs at which sub stage of prophase I in meiosis?
| 1. | Diakinesis | 2. | Zygotene |
| 3. | Pachytene | 4. | Diplotene |
108. Which of the following stages of meiosis involves division of centromere?
| 1. | Telophase | 2. | Metaphase I |
| 3. | Metaphase II | 4. | Anaphase II |
109. Identify the correct statements:
| A: |
Detrivores perform fragmentation. |
| B: |
The humus is further degraded by some microbes during mineralization. |
| C: |
Water soluble inorganic nutrients go down into the soil and get precipitated by a process called leaching. |
| D: |
The detritus food chain begins with living organisms. |
| E: |
Earthworms break down detritus into smaller particles by a process called catabolism. |
Choose the correct answer from the options given below:
| 1. |
D, E, A only |
2. |
A, B, C only |
| 3. |
B, C, D only |
4. |
C, D, E only |
110. In angiosperm, the haploid, diploid and triploid structures of a fertilized embryo sac sequentially are :
| 1. |
Synergids, antipodals and Polar nuclei |
| 2. |
Synergids, Primary endosperm nucleus and zygote |
| 3. |
Antipodals, synergids, and primary endosperm nucleus |
| 4. |
Synergids, Zygote and Primary endosperm nucleus |
111. Among 'The Evil Quartet', which one is considered the most important cause driving extinction of species?
1. Co-extinctions
2. Habitat loss and fragmentation
3. Over exploitation for economic gain
4. Alien species invasions
112. In tissue culture experiments, leaf mesophyll cells are put in a culture medium to form callus. This phenomenon may be called as
| 1. |
Senescence |
2. |
Differentiation |
| 3. |
Dedifferentiation |
4. |
Development |
113. In gene gun method used to introduce alien DNA into host cells, microparticles of ___________ metal are used.
| 1. |
Silver |
2. |
Copper |
| 3. |
Zinc |
4. |
Tungsten or gold |
114. Large, colorful, fragrant flowers with nectar are seen in:
| 1. |
wind pollinated plants |
2. |
insect pollinated plants |
| 3. |
bird pollinated plants |
4. |
bat pollinated plants |
115. Expressed Sequence Tags (ESTs) refers to:
1. Certain important expressed genes.
2. All genes that are expressed as RNA.
3. All genes that are expressed as proteins.
4. All genes whether expressed or unexpressed
116. Given below are two statements : One is labelled as
Assertion (A) and the other is labelled as
Reason (R):
| Assertion (A): |
ATP is used at two steps in glycolysis. |
| Reason (R): |
First ATP is used in converting glucose into glucose-6-phosphate and second ATP is used in conversion of fructose-6-phosphate into fructose-1-6-diphosphate. |
In the light of the above statements, choose the correct answer from the options given below :
| 1. |
(A) is False but (R) is True. |
| 2. |
Both (A) and (R) are True and (R) is the correct explanation of (A). |
| 3. |
Both (A) and (R) are True but (R) is not the correct explanation of (A). |
| 4. |
(A) is True but (R) is False. |
117. Spraying of which of the following phytohormone on juvenile conifers helps in hastening the maturity period, that leads to early seed production?
| 1. |
Abscisic Acid |
2. |
Indole-3-butyric Acid |
| 3. |
Gibberellic Acid |
4. |
Zeatin |
118. Identify the pair of heterosporous pteridophytes among the following :
1. Equisetum and Salvinia
2. Lycopodium and Selaginella
3. Selaginella and Salvinia
4. Psilotum and Salvinia
119. In a dicot stem, the term ‘starch sheath’ is often used to indicate:
1. The hypodermis
2. The endodermis
3. The pericycle
4. The medullary rays
120. What is the role of RNA polymerase III in the process of transcription in Eukaryotes?
1. Transcription of only snRNAs
2. Transcription of rRNAs (28S, 18S and 5.8S)
3. Transcription of tRNA, 5 srRNA and snRNA
4. Transcription of precursor of mRNA
121. How many ATP and NADPH
2 are required for the synthesis of one molecule of glucose during Calvin cycle?
| 1. |
18 ATP and 16 NADPH2 |
| 2. |
12 ATP and 12 NADPH2 |
| 3. |
18 ATP and 12 NADPH2 |
| 4. |
12 ATP and 16 NADPH2 |
122. How many different proteins does the ribosome consist of?
123. Match
List-I with
List-II
|
List-I |
|
List-II |
| A. |
Oxidative decarboxylation |
I. |
Citrate synthase |
| B. |
Glycolysis |
II. |
Pyruvate dehydrogenase |
| C. |
Oxidative phosphorylation |
III. |
Electron transport system |
| D. |
Tricarboxylic acid cycle |
IV. |
EMP pathway |
Choose the correct answer from the options given below:
| Options: |
A |
B |
C |
D |
| 1. |
II |
IV |
III |
I |
| 2. |
III |
IV |
II |
I |
| 3. |
II |
IV |
I |
III |
| 4. |
III |
I |
II |
IV |
124. Match
List-I with
List-II
|
List-I
(Interaction) |
|
List-II
(Species A and B) |
| A. |
Mutualism |
I. |
+(A), O(B) |
| B. |
Commensalism |
II. |
–(A), O(B) |
| C. |
Amensalism |
III. |
+(A), –(B) |
| D. |
Parasitism |
IV |
+(A), +(B) |
Choose the correct answer from the options given below:
| Options: |
A |
B |
C |
D |
| 1. |
III |
I |
IV |
II |
| 2. |
IV |
II |
I |
II |
| 3. |
IV |
I |
II |
III |
| 4. |
IV |
III |
I |
II |
125. Given below are two statements:
| Statement I: |
Gause's 'Competitive Exclusion Principle' states that two closely related species competing for the same resources cannot co-exist indefinitely and competitively inferior one will be eliminated eventually. |
| Statement II: |
In general, carnivores are more adversely affected by competition than herbivores. |
In the light of the above statements, choose the correct answer from the options given below:
1.
Statement I is incorrect but
Statement II is correct.
2. Both
Statement I and
Statement II are correct.
3. Both
Statement I and
Statement II are incorrect.
4.
Statement I is correct but
Statement II is incorrect.
126. Identify the correct statements:
| A: |
Lenticels are the lens-shaped openings permitting the exchange of gases. |
| B: |
Bark formed early in the season is called hard bark. |
| C: |
Bark is a technical term that refers to all tissues exterior to vascular cambium. |
| D: |
Bark refers to periderm and secondary phloem. |
| E: |
Phellogen is single- layered in thickness. |
Choose the correct answer from the options given below:
| 1. |
B and C only |
2. |
B, C and E only |
| 3. |
A and D only |
4. |
A, B and D only |
127. Main steps in the formation of Recombinant DNA are given below. Arrange these steps in a correct sequence.
| A. |
Insertion of recombinant DNA into the host cell. |
| B. |
Cutting of DNA at specific location by restriction enzyme. |
| C. |
Isolation of desired DNA fragment. |
| D. |
Amplification of gene of interest using PCR. |
Choose the correct answer from the options given below:
| 1. |
B, D, A, C |
2. |
B, C, D, A |
| 3. |
C, A, B, D |
4. |
C, B, D, A |
128. Given below are two statements: One is labelled as
Assertion (A) and the other is labelled as
Reason (R):
| Assertion (A): |
In gymnosperms, the pollen grains are released from the microsporangium and carried by air currents. |
| Reason (R): |
Air currents carry the pollen grains to the mouth of the archegonia where the male gametes are discharged and pollen tube is not formed. |
In the light of the above statements, choose the correct answer from the options given below:
| 1. |
(A) is False, (R) is True. |
| 2. |
Both (A) and (R) are True and (R) correctly explains (A). |
| 3. |
Both (A) and (R) are True and (R) does not correctly explain (A). |
| 4. |
(A) is True, (R) is False. |
129. Which of the following statements are correct about Klinefelter's Syndrome?
| A. |
This disorder was first described by Langdon Down (1866). |
| B. |
Such an individual has overall masculine development. However, the feminine development is also expressed. |
| C. |
The affected individual is short statured. |
| D. |
Physical, psychomotor and mental development is retarded. |
| E. |
Such individuals are sterile. |
Choose the correct answer from the options given below:
| 1. |
A and E only |
2. |
A and B only |
| 3. |
C and D only |
4. |
B and E only |
130. Given below are two statements. One is labelled as
Assertion (A) and the other is labelled as
Reason (R):
| Assertion (A): |
A flower is defined as a modified shoot wherein the shoot apical meristem changes to floral meristem. |
| Reason (R): |
Internode of the shoot gets condensed to produce different floral appendages laterally at successive nodes instead of leaves. |
In the light of the above statements, choose the correct answer from the options given below:
| 1. |
(A) is False but (R) is True. |
| 2. |
Both (A) and (R) are True and (R) is the correct explanation of (A). |
| 3. |
Both (A) and (R) are True but (R) is not the correct explanation of (A). |
| 4. |
(A) is True but (R) is False. |
131. Match List I with List II:
|
List I |
|
List II |
| A. |
M Phase |
I. |
Proteins are synthesized |
| B. |
G2 Phase |
II. |
Inactive phase |
| C. |
Quiescent stage |
III. |
Interval between mitosis and initiation
of DNA replication |
| D. |
G1 Phase |
IV. |
Equational division |
Choose the correct answer from the options given below:
| Options: |
A |
B |
C |
D |
| 1. |
II |
IV |
I |
III |
| 2. |
III |
II |
IV |
I |
| 3. |
IV |
II |
I |
III |
| 4. |
IV |
I |
II |
III |
132. Malonate inhibits the growth of pathogenic bacteria by inhibiting the activity of:
| 1. |
Dinitrogenase |
2. |
Succinic dehydrogenase |
| 3. |
Amylase |
4. |
Lipase |
133. Which of the following combinations is required for chemiosmosis?
| 1. |
Proton pump, electron gradient, NADP synthase. |
| 2. |
Membrane, proton pump, proton gradient, ATP synthase. |
| 3. |
Membrane, proton pump, proton gradient, NADP synthase |
| 4. |
Proton pump, electron gradient, ATP synthase |
134. Broad palm with single palm crease is visible in a person suffering from-
| 1. | Thalassemia | 2. | Down's syndrome |
| 3. | Turner's syndrome | 4. | Klinefelter's syndrome |
135. Given below are two statements:
| Statement I: |
Low temperature preserves the enzyme in a temporarily inactive state whereas high temperature destroys enzymatic activity because proteins are denatured by heat. |
| Statement II: |
When the inhibitor closely resembles the substrate in its molecular structure and inhibits the activity of the enzyme, it is known as competitive inhibitor. |
In the light of the above statements, choose the correct answer from the options given below:
1.
Statement I is false but
Statement II is true.
2. Both
Statement I and
Statement II are true.
3. Both
Statement I and
Statement II are false.
4.
Statement I is true but
Statement II is false.
136. Which one of the following common sexually transmitted diseases is completely curable when detected early and treated properly?
| 1. |
HIV Infection |
2. |
Genital herpes |
| 3. |
Gonorrhoea |
4. |
Hepatitis-B |
137. Given below are two statements:
| Statement I: |
Vas deferens receives a duct from seminal vesicle and opens into urethra as the ejaculatory duct. |
| Statement II: |
The cavity of the cervix is called cervical canal which along with vagina forms birth canal. |
In light of the above statements, choose the correct answer from the options given below:
1.
Statement I is incorrect but
Statement II is correct.
2. Both
Statement I and
Statement II are correct.
3. Both
Statement I and
Statement II are incorrect.
4.
Statement I is correct but
Statement II is incorrect.
138. Which one of the following symbols represents mating between relatives in human pedigree analysis?
139. Match
List-I with
List-II.
|
List-I |
|
List-II |
| A. |
Taenia |
I. |
Nephridia |
| B. |
Paramoecium |
II. |
Contractile vacuole |
| C. |
Periplaneta |
III. |
Flame cells |
| D. |
Pheretima |
IV. |
Urecose gland |
Choose the correct answer from the options given below:
| Options: |
A |
B |
C |
D |
| 1. |
II |
I |
IV |
III |
| 2. |
I |
II |
III |
IV |
| 3. |
I |
II |
IV |
III |
| 4. |
III |
II |
IV |
I |
140. Given below are two statements:
| Statement I: |
In prokaryotes, the positively charged DNA is held with some negatively charged proteins in a region called nucleoid. |
| Statement II: |
In eukaryotes, the negatively charged DNA is wrapped around the positively charged histone octamer to form nucleosome. |
In the light of the above statements, choose the correct answer from the options given below:
1.
Statement I is incorrect but
Statement II is correct.
2. Both
Statement I and
Statement II are correct.
3. Both
Statement I and
Statement II are incorrect.
4.
Statement I is correct but
Statement II is incorrect.
141. Which of the following functions is carried out by the cytoskeleton in a cell?
| 1. |
Transportation |
2. |
Nuclear division |
| 3. |
Protein synthesis |
4. |
Motility |
142. Given below are two statements:
| Statement I: |
Ligaments are dense irregular tissue. |
| Statement II: |
Cartilage is dense regular tissue. |
In the light of the above statements, choose the correct answer from the options given below:
| 1. |
Statement I is false but Statement II is true. |
| 2. |
Both Statement I and Statement II are true. |
| 3. |
Both Statement I and Statement II are false. |
| 4. |
Statement I is true but Statement II is false. |
143. Which of the following are not considered as part of endomembrane system?
| A: |
Mitochondria |
| B: |
Endoplasmic Reticulum |
| C: |
Chloroplasts |
| D: |
Golgi complex |
| E: |
Peroxisomes |
Choose the most appropriate answer from the options given below:
| 1. |
A, D and E only |
2. |
B and D only |
| 3. |
A, C and E only |
4. |
A and D only |
144. Given below are two statements: one is labelled as Assertion (A) and the other is labelled s Reason (R).
| Assertion (A): |
Amniocentesis for sex determination is one of the strategies of Reproductive and Child Health Care Programme. |
| Reason (R): |
Ban on amniocentesis checks increasing menace of female foeticide. |
In the light of the above statements, choose the correct answer from the options given below:
| 1. |
(A) is False but (R) is True. |
| 2. |
Both (A) and (R) are True and (R) is the correct explanation of (A). |
| 3. |
Both (A) and (R) are True but (R) is not the correct explanation of (A). |
| 4. |
(A) is True but (R) is False. |
145. Given below are statements: one is labelled as
Assertion (A) and the other is labelled as
Reason (R).
| Assertion (A): |
Nephrons are of two types: Cortical & Juxta medullary, based on their relative position in cortex and medulla. |
| Reason (R): |
Juxta medullary nephrons have short-loop of Henle whereas, cortical nephrons have longer loop of Henle. |
In the light of the above statements, choose the correct answer from the options given below:
| 1. |
(A) is False, (R) is True. |
| 2. |
Both (A) and (R) are True and (R) correctly explains (A). |
| 3. |
Both (A) and (R) are True but (R) does not correctly explain (A). |
| 4. |
(A) is True, (R) is False. |
146. Match
List-I with
List-II
|
List-I
(Type of Joint) |
|
List-II
(Found between) |
| A. |
Cartilaginous Joint |
I. |
Between flat skull bones |
| B. |
Ball and Socket Joint |
II. |
Between adjacent vertebrae in vertebral column |
| C. |
Fibrous Joint |
III. |
Between carpal and metacarpal of thumb |
| D. |
Saddle Joint |
IV. |
Between Humerus and Pectoral girdle |
Choose the correct answer from the options given below:
| Options: |
A |
B |
C |
D |
| 1. |
II |
IV |
III |
I |
| 2. |
III |
I |
II |
IV |
| 3. |
II |
IV |
I |
III |
| 4. |
I |
IV |
III |
II |
147. Vital capacity of lung is
| 1. |
IRV + ERV + TV |
2. |
IRV + ERV |
| 3. |
IRV + ERV + TV + RV |
4. |
IRV + ERV + TV - RV |
148. Match
List-I with
List-II
|
List-I |
|
List-II |
| A. |
Ringworm |
I. |
Haemophilus influenza |
| B. |
Filariasis |
II. |
Trichophyton |
| C. |
Malaria |
III. |
Wuchereria bancrofti |
| D. |
Pneumonia |
IV. |
Plasmodium vivax |
Choose the correct answer from the options given below:
| Options: |
A |
B |
C |
D |
| 1. |
III |
II |
IV |
I |
| 2. |
II |
III |
IV |
I |
| 3. |
II |
III |
I |
IV |
| 4. |
III |
II |
I |
IV |
149. In which blood corpuscles, the HIV undergoes replication and produces progeny viruses?
| 1. |
Eosinophils |
2. |
TH cells |
| 3. |
B-lymphocytes |
4. |
Basophils |
150. Match List I with List II
|
List I |
|
List II |
| A. |
Gene 'a' |
I. |
\(\beta\)-galactosidase |
| B. |
Gene 'y' |
II. |
Transacetylase |
| C. |
Gene 'i' |
III. |
Permease |
| D. |
Gene 'z' |
IV. |
Repressor protein |
Choose the correct answer from the options given below:
| Options: |
A |
B |
C |
D |
| 1. |
III |
I |
IV |
II |
| 2. |
II |
I |
IV |
III |
| 3. |
II |
III |
IV |
I |
| 4. |
III |
IV |
I |
II |
151. In the nervous system of lower invertebrates such as Hydra, neural organization is primarily structured as a:
1. Centralized nervous system with brain and ganglia
2. Network of neurons without central processing
3. Reflex arc mechanism only
4. Diffused arrangement of sensory and motor neurons
152. Select the correct group/set of Australian Marsupials exhibiting adaptive radiation.
| 1. |
Lemur, Anteater, Wolf |
| 2. |
Tasmanian wolf, Bobcat, Marsupial mole |
| 3. |
Numbat, Spotted cuscus, Flying phalanger |
| 4. |
Mole, Flying squirrel, Tasmanian tiger cat |
153. Which of the following statements are correct regarding female reproductive cycle?
| A. |
In non-primate mammals, cyclical changes during reproduction are called oestrus cycle. |
| B. |
First menstrual cycle begins at puberty and is called menopause. |
| C. |
Lack of menstruation may be indicative of pregnancy. |
| D. |
Cyclic menstruation extends between menarche and menopause. |
Choose the most appropriate answer from the options given below:
| 1. |
A, C and D only |
2. |
A and D only |
| 3. |
A and B only |
4. |
A, B and C only |
154. Given below are two statements: one is labelled as Assertion (A) and the other is labelled as Reason (R).
| Assertion (A): |
Endometrium is necessary for implantation of blastocyst. |
| Reason (R): |
In the absence of fertilization, the corpus luteum degenerates that causes disintegration of endometrium. |
In the light of the above statements, choose the correct answer from, the options given below:
| 1. |
(A) is False but (R) is True. |
| 2. |
Both (A) and (R) are True and (R) is the correct explanation of (A). |
| 3. |
Both (A) and (R) are True but (R) is not the correct explanation of (A). |
| 4. |
(A) is True but (R) is False. |
155. Match
List-I with
List-II
|
List-I |
|
List-II |
| A. |
Heroin |
I. |
Effect on cardiovascular system |
| B. |
Marijuana |
II. |
Slows down body function |
| C. |
Cocaine |
III. |
Painkiller |
| D. |
Morphine |
IV. |
Interferes with transport of dopamine |
Choose the correct answer from the options given below:
| Options: |
A |
B |
C |
D |
| 1. |
III |
IV |
I |
II |
| 2. |
II |
I |
IV |
III |
| 3. |
I |
II |
III |
IV |
| 4. |
IV |
III |
II |
I |
156. Which of the following is not a cloning vector?
| 1. |
Probe |
2. |
BAC |
| 3. |
YAC |
4. |
PBR322 |
157. Consider the given two statements:
| Statement I: |
Electron transport chain is located in the outer mitochondrial membrane. |
| Statement II: |
NADH and FADH2 donate electrons to the electron transport chain. |
| 1. |
Statement I is correct; Statement II is correct |
| 2. |
Statement I is correct; Statement II is incorrect |
| 3. |
Statement I is incorrect; Statement II is correct |
| 4. |
Statement I is incorrect; Statement II is incorrect |
158. Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its early treatment?
| 1. |
Enzyme Linked Immuno-Sorbent Assay (ELISA) technique |
| 2. |
Recombinant DNA Technology |
| 3. |
Serum and Urine analysis |
| 4. |
Polymerase Chain Reaction (PCR) technique |
159. Given below are two statements:
| Statement I: |
RNA mutates at a faster rate. |
| Statement II: |
Viruses having RNA genome and shorter life span mutate and evolve faster. |
In the light of the above statements, choose the correct answer from the options given below:
| 1. |
Statement I is false but Statement II is true. |
| 2. |
Both Statement I and Statement II are true. |
| 3. |
Both Statement I and Statement II are false. |
| 4. |
Statement I is true but Statement II is false. |
160. Match
List-I with
List-II
|
List-I |
|
List-II |
| A. |
CCK |
I. |
Kidney |
| B. |
GIP |
II. |
Heart |
| C. |
ANF |
III. |
Gastric gland |
| D |
ADH |
IV. |
Pancreas |
Choose the correct answer from the options given below:
| Options: |
(a) |
(b) |
(c) |
(d) |
| 1. |
IV |
II |
III |
I |
| 2. |
IV |
III |
II |
I |
| 3. |
III |
II |
IV |
I |
| 4. |
II |
IV |
I |
III |
161. Given below are two statements:
| Statement I: |
A protein is imagined as a line, the left end represented by first amino acid (C-terminal) and the right end represented by last amino acid (N-terminal). |
| Statement II: |
Adult human haemoglobin, consists of 4 subunits (two subunits of \(\alpha\) type and two subunits of ẞ type.) |
In the light of the above statements, choose the correct answer from the options given below:
| 1. |
Statement I is false but Statement II is true. |
| 2. |
Both Statement I and Statement II are true. |
| 3. |
Both Statement I and Statement II are false. |
| 4. |
Statement I is true but Statement II is false. |
162. Match
List-I with
List-II
|
List-I (Interacting species) |
|
List-II (Name of Interaction) |
| A. |
A Leopard and a Lion in a Forest/grassland |
I. |
Competition |
| B. |
A Cuckoo laying an egg in a Crow's nest |
II. |
Brood parasitism |
| C. |
Fungi and root of a higher plant mycorrhizae |
III. |
Mutualism |
| D. |
A cattle egret and a Cattle in a field |
IV. |
Commensalism |
Choose the correct answer from the options given below:
| Options: |
A |
B |
C |
D |
| 1. |
II |
III |
I |
IV |
| 2. |
I |
II |
III |
IV |
| 3. |
I |
II |
IV |
III |
| 4. |
III |
IV |
I |
II |
163. Match
List-I with
List-II
|
List-I |
|
List-II |
| A. |
P-wave |
I. |
Beginning of systole |
| B. |
Q-wave |
II. |
Repolarisation of ventricles |
| C. |
QRS complex |
III. |
Depolarisation of atria |
| D. |
T-wave |
IV. |
Depolarisation of ventricles |
Choose the correct answer from the options given below:
| Options: |
A |
B |
C |
D |
| 1. |
I |
II |
III |
IV |
| 2. |
III |
I |
IV |
II |
| 3. |
IV |
III |
II |
I |
| 4. |
II |
IV |
I |
II |
164. Radial symmetry is not found in adults of phylum__________
| 1. |
Echinodermata D |
2. |
Ctenophora |
| 3. |
Hemichordata |
4. |
Coelenterata |
165. Match
List-I with
List-II
|
List-I |
|
List-II |
| A. |
Vasectomy |
I. |
Oral method |
| B. |
Coitus interruptus |
II. |
Barrier method |
| C. |
Cervical caps |
III. |
Surgical method |
| D. |
Saheli |
IV. |
Natural method |
Choose the correct answer from the options given below:
| Options: |
A |
B |
C |
D |
| 1. |
IV |
II |
I |
III |
| 2. |
III |
I |
IV |
II |
| 3. |
III |
IV |
II |
I |
| 4. |
II |
III |
I |
IV |
166. Which of the following statements are correct?
| A: |
Basophils are most abundant cells of the total WBCs. |
| B: |
Basophils secrete histamine, serotonin and heparin. |
| C: |
Basophils are involved in inflammatory response. |
| D: |
Basophils have kidney shaped nucleus. |
| E: |
Basophils are agranulocytes. |
Choose the correct answer from the options given below:
| 1. |
A and B only |
2. |
D and E only |
| 3. |
C and E only |
4. |
B and C only |
167. Select the correct statements.
| A. |
Tetrad formation is seen during Leptotene. |
| B. |
During Anaphase, the centromeres split and chromatids separate. |
| C. |
Terminalization takes place during Pachytene. |
| D. |
Nucleolus, Golgi complex and ER are reformed during Telophase. |
| E. |
Crossing over takes place between sister chromatids of homologous chromosome. |
Choose the correct answer from the options given below:
| 1. |
B and E only |
2. |
A and C only |
| 3. |
B and D only |
4. |
A, C and E only |
168. Select the correct statements with reference to chordates.
| A: |
Presence of a mid-dorsal, solid and double nerve cord. |
| B: |
Presence of closed circulatory system. |
| C: |
Presence of paired pharyngeal gill slits |
| D: |
Presence of dorsal heart. |
| E: |
Triploblastic pseudocoelomate animals. |
Choose the correct answer from the options given below:
| 1. |
C, D and E only |
2. |
A, C and D only |
| 3. |
B and C only |
4. |
B, D and E only |
169. Which of the following statements are correct regarding skeletal muscle?
| A: |
Muscle bundles are held together by collagenous connective tissue layer called fascicle. |
| B: |
Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions. |
| C: |
Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins. |
| D: |
M line is considered as functional unit of contraction called sarcomere. |
Choose the most appropriate answer from the options given below:
| 1. |
C and D only |
2. |
A, B and C only |
| 3. |
B and C only |
4. |
A, C and D only |
170. Given below are two-statements:
| Statement I: |
During G0 phase of cell cycle, the cell is metabolically inactive. |
| Statement II: |
The centrosome undergoes duplication during S phase of interphase. |
In the light of the above statements, choose the most appropriate answer from the options given below:
| 1. |
Statement I is incorrect but Statement II is correct. |
| 2. |
Both Statement I and Statement II are correct. |
| 3. |
Both Statement I and Statement II are incorrect. |
| 4. |
Statement I is correct but Statement II is incorrect. |
171. Different species of a genus
| 1. |
Are very different from each other in their basic properties |
| 2. |
Have morphological similarities |
| 3. |
Can be placed in different families |
| 4. |
Cannot be differentiated on the basis of their morphological features |
172. Which of the following statements are correct?
| A: |
An excessive loss of body fluid from the body switches off osmoreceptors. |
| B: |
ADH facilitates water reabsorption to prevent diuresis. |
| C: |
ANF causes vasodilation. |
| D: |
ADH causes increase in blood pressure. |
| E: |
ADH is responsible for decrease in GFR. |
Choose the correct answer from the options given below:
| 1. |
C, D and E only |
2. |
A and B only |
| 3. |
B, C and D only |
4. |
A, B and E only |
173. Which of the following are not under the control of thyroid hormone?
| A. |
Maintenance of water and electrolyte balance. |
| B. |
Regulation of basal metabolic rate. |
| C. |
Normal rhythm of sleep-wake cycle. |
| D. |
Development of immune system. |
| E. |
Support the process of formation of RBCs. |
Choose the correct answer from the options given below:
| 1. |
D and E only |
2. |
A and D only |
| 3. |
B and C only |
4. |
C and D only |
174. The parts of the human brain that help in the regulation of sexual behavior, expression of excitement, pleasure, rage, fear, etc. are:
1. Corpus callosum and thalamus
2. Limbic system & hypothalamus
3. Corpora quadrigemina & hippocampus
4. Brain stem & epithalamus
175. Match
List-I with
List-II.
|
List-I |
|
List-II |
| A. |
Logistic growth |
I. |
Unlimited resource availability condition |
| B. |
Exponential growth |
II. |
Limited resource availability condition |
| C. |
Expanding age pyramid |
III. |
The percent individuals of pre-reproductive age is largest followed by reproductive and post reproductive age groups |
| D. |
Stable age pyramid |
IV. |
The percent individuals of pre-reproductives and reproductive age group are same |
Choose the correct answer from the options given below:
| Options: |
A |
B |
C |
D |
| 1. |
II |
IV |
III |
I |
| 2. |
II |
I |
III |
IV |
| 3. |
II |
III |
I |
IV |
| 4. |
II |
IV |
I |
III |
176. Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follows
5'AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3'?
| 1. |
3' ATCGATCGATCGATCGATCGATCGATCG 5' |
| 2. |
5' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 3' |
| 3. |
3' UAGCUAGCUAGCUAGCUAGCUAGCUAGC 5' |
| 4. |
5' ATCGATCGATCGATCGATCGATCGATCG 3' |
177. Which of the following is the characteristic
feature of cockroach regarding sexual dimorphism?
1. Presence of anal cerci
2. Dark brown body colour and anal cerci
3. Presence of anal styles
4. Presence of sclerites
178. Match
List-I with
List-II.
|
List-I |
|
List-II |
| A. |
Mast cells |
I. |
Ciliated epithelium |
| B. |
Inner surface of bronchiole |
II. |
Areolar connective tissue |
| C. |
Blood |
III. |
Cuboidal epithelium |
| D. |
Tubular parts of nephron |
IV. |
Specialised connective tissue |
Choose the correct answer from the options given below:
| Options: |
A |
B |
C |
D |
| 1. |
III |
IV |
II |
I |
| 2. |
I |
II |
IV |
III |
| 3. |
II |
III |
I |
IV |
| 4. |
II |
I |
IV |
III |
179. The unique mammalian characteristics are:
1. pinna, monocondylic skull and mammary glands
2. hairs, tympanic membrane and mammary glands
3. hairs, pinna and mammary glands
4. hairs, pinna and indirect development
180. In cockroach, excretion is brought about by:
| A. |
Phallic gland |
| B. |
Urecose gland |
| C. |
Nephrocytes |
| D. |
Fat body |
| E. |
Collaterial glands |
Choose the correct answer from the options given below:
| 1. |
B and D only |
2. |
A and E only |
| 3. |
A, B and E only |
4. |
B, C and D only |
*If above link doesn't work, please go to test link from where you got the pdf and fill OMR from there
CLICK HERE to get FREE ACCESS for 2 days of ANY NEETprep course